ID: 1062318909

View in Genome Browser
Species Human (GRCh38)
Location 9:135981000-135981022
Sequence CGCTGATGCCAGCCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062318909_1062318914 -8 Left 1062318909 9:135981000-135981022 CCATGGCCAGGCTGGCATCAGCG No data
Right 1062318914 9:135981015-135981037 CATCAGCGGCCTGGGCACCATGG No data
1062318909_1062318915 -3 Left 1062318909 9:135981000-135981022 CCATGGCCAGGCTGGCATCAGCG No data
Right 1062318915 9:135981020-135981042 GCGGCCTGGGCACCATGGCTAGG No data
1062318909_1062318920 27 Left 1062318909 9:135981000-135981022 CCATGGCCAGGCTGGCATCAGCG No data
Right 1062318920 9:135981050-135981072 ACACGAGCTGCATTCAGATCTGG No data
1062318909_1062318917 2 Left 1062318909 9:135981000-135981022 CCATGGCCAGGCTGGCATCAGCG No data
Right 1062318917 9:135981025-135981047 CTGGGCACCATGGCTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062318909 Original CRISPR CGCTGATGCCAGCCTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr