ID: 1062319300

View in Genome Browser
Species Human (GRCh38)
Location 9:135982631-135982653
Sequence TAGTGGCCCTGAGGCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319300_1062319313 19 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319313 9:135982673-135982695 AGGAGGAGCGGTCCCGGGCAGGG No data
1062319300_1062319310 14 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319310 9:135982668-135982690 CAGCCAGGAGGAGCGGTCCCGGG No data
1062319300_1062319309 13 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319309 9:135982667-135982689 TCAGCCAGGAGGAGCGGTCCCGG No data
1062319300_1062319306 2 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319306 9:135982656-135982678 GCGGATGGCCATCAGCCAGGAGG No data
1062319300_1062319307 7 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319307 9:135982661-135982683 TGGCCATCAGCCAGGAGGAGCGG No data
1062319300_1062319305 -1 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319305 9:135982653-135982675 AACGCGGATGGCCATCAGCCAGG No data
1062319300_1062319312 18 Left 1062319300 9:135982631-135982653 CCAGGGATGCCTCAGGGCCACTA No data
Right 1062319312 9:135982672-135982694 CAGGAGGAGCGGTCCCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319300 Original CRISPR TAGTGGCCCTGAGGCATCCC TGG (reversed) Intergenic
No off target data available for this crispr