ID: 1062319529

View in Genome Browser
Species Human (GRCh38)
Location 9:135984061-135984083
Sequence GGGGGAGGGGTCCTGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319529_1062319547 28 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319547 9:135984112-135984134 TCCTGTCCTCAGAGGAGGACAGG No data
1062319529_1062319544 23 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319529_1062319550 30 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319550 9:135984114-135984136 CTGTCCTCAGAGGAGGACAGGGG No data
1062319529_1062319549 29 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319549 9:135984113-135984135 CCTGTCCTCAGAGGAGGACAGGG No data
1062319529_1062319542 20 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319542 9:135984104-135984126 ACCAGCCCTCCTGTCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319529 Original CRISPR GGGGGAGGGGTCCTGGGCAG TGG (reversed) Intergenic