ID: 1062319532

View in Genome Browser
Species Human (GRCh38)
Location 9:135984074-135984096
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319532_1062319550 17 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319550 9:135984114-135984136 CTGTCCTCAGAGGAGGACAGGGG No data
1062319532_1062319555 26 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319532_1062319542 7 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319542 9:135984104-135984126 ACCAGCCCTCCTGTCCTCAGAGG No data
1062319532_1062319553 21 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG No data
1062319532_1062319547 15 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319547 9:135984112-135984134 TCCTGTCCTCAGAGGAGGACAGG No data
1062319532_1062319554 22 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319554 9:135984119-135984141 CTCAGAGGAGGACAGGGGAGGGG No data
1062319532_1062319544 10 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319532_1062319549 16 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319549 9:135984113-135984135 CCTGTCCTCAGAGGAGGACAGGG No data
1062319532_1062319551 20 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319551 9:135984117-135984139 TCCTCAGAGGAGGACAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319532 Original CRISPR GAGCAGGGGTGCAGGGGGAG GGG (reversed) Intergenic