ID: 1062319534

View in Genome Browser
Species Human (GRCh38)
Location 9:135984076-135984098
Sequence CTGAGCAGGGGTGCAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319534_1062319553 19 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG No data
1062319534_1062319549 14 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319549 9:135984113-135984135 CCTGTCCTCAGAGGAGGACAGGG No data
1062319534_1062319555 24 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319534_1062319547 13 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319547 9:135984112-135984134 TCCTGTCCTCAGAGGAGGACAGG No data
1062319534_1062319551 18 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319551 9:135984117-135984139 TCCTCAGAGGAGGACAGGGGAGG No data
1062319534_1062319550 15 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319550 9:135984114-135984136 CTGTCCTCAGAGGAGGACAGGGG No data
1062319534_1062319542 5 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319542 9:135984104-135984126 ACCAGCCCTCCTGTCCTCAGAGG No data
1062319534_1062319544 8 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319534_1062319554 20 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319554 9:135984119-135984141 CTCAGAGGAGGACAGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319534 Original CRISPR CTGAGCAGGGGTGCAGGGGG AGG (reversed) Intergenic