ID: 1062319543

View in Genome Browser
Species Human (GRCh38)
Location 9:135984105-135984127
Sequence TCCTCTGAGGACAGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319543_1062319553 -10 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG No data
1062319543_1062319554 -9 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319554 9:135984119-135984141 CTCAGAGGAGGACAGGGGAGGGG No data
1062319543_1062319556 7 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319543_1062319555 -5 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319543 Original CRISPR TCCTCTGAGGACAGGAGGGC TGG (reversed) Intergenic