ID: 1062319544

View in Genome Browser
Species Human (GRCh38)
Location 9:135984107-135984129
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319532_1062319544 10 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319533_1062319544 9 Left 1062319533 9:135984075-135984097 CCCTCCCCCTGCACCCCTGCTCA No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319534_1062319544 8 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319531_1062319544 16 Left 1062319531 9:135984068-135984090 CCAGGACCCCTCCCCCTGCACCC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319537_1062319544 3 Left 1062319537 9:135984081-135984103 CCCTGCACCCCTGCTCAGCTACA No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319529_1062319544 23 Left 1062319529 9:135984061-135984083 CCACTGCCCAGGACCCCTCCCCC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319541_1062319544 -6 Left 1062319541 9:135984090-135984112 CCTGCTCAGCTACAACCAGCCCT No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319536_1062319544 4 Left 1062319536 9:135984080-135984102 CCCCTGCACCCCTGCTCAGCTAC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319540_1062319544 -5 Left 1062319540 9:135984089-135984111 CCCTGCTCAGCTACAACCAGCCC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319538_1062319544 2 Left 1062319538 9:135984082-135984104 CCTGCACCCCTGCTCAGCTACAA No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319539_1062319544 -4 Left 1062319539 9:135984088-135984110 CCCCTGCTCAGCTACAACCAGCC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319535_1062319544 5 Left 1062319535 9:135984079-135984101 CCCCCTGCACCCCTGCTCAGCTA No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data
1062319530_1062319544 17 Left 1062319530 9:135984067-135984089 CCCAGGACCCCTCCCCCTGCACC No data
Right 1062319544 9:135984107-135984129 AGCCCTCCTGTCCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319544 Original CRISPR AGCCCTCCTGTCCTCAGAGG AGG Intergenic