ID: 1062319546

View in Genome Browser
Species Human (GRCh38)
Location 9:135984110-135984132
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319546_1062319555 -10 Left 1062319546 9:135984110-135984132 CCTCCTGTCCTCAGAGGAGGACA No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319546_1062319556 2 Left 1062319546 9:135984110-135984132 CCTCCTGTCCTCAGAGGAGGACA No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319546 Original CRISPR TGTCCTCCTCTGAGGACAGG AGG (reversed) Intergenic