ID: 1062319548

View in Genome Browser
Species Human (GRCh38)
Location 9:135984113-135984135
Sequence CCCTGTCCTCCTCTGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319548_1062319556 -1 Left 1062319548 9:135984113-135984135 CCTGTCCTCAGAGGAGGACAGGG No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319548 Original CRISPR CCCTGTCCTCCTCTGAGGAC AGG (reversed) Intergenic