ID: 1062319552

View in Genome Browser
Species Human (GRCh38)
Location 9:135984118-135984140
Sequence CCCTCCCCTGTCCTCCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319552_1062319556 -6 Left 1062319552 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319552 Original CRISPR CCCTCCCCTGTCCTCCTCTG AGG (reversed) Intergenic
No off target data available for this crispr