ID: 1062319555

View in Genome Browser
Species Human (GRCh38)
Location 9:135984123-135984145
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319541_1062319555 10 Left 1062319541 9:135984090-135984112 CCTGCTCAGCTACAACCAGCCCT 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319546_1062319555 -10 Left 1062319546 9:135984110-135984132 CCTCCTGTCCTCAGAGGAGGACA No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319535_1062319555 21 Left 1062319535 9:135984079-135984101 CCCCCTGCACCCCTGCTCAGCTA 0: 1
1: 1
2: 2
3: 30
4: 356
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319538_1062319555 18 Left 1062319538 9:135984082-135984104 CCTGCACCCCTGCTCAGCTACAA No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319536_1062319555 20 Left 1062319536 9:135984080-135984102 CCCCTGCACCCCTGCTCAGCTAC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319539_1062319555 12 Left 1062319539 9:135984088-135984110 CCCCTGCTCAGCTACAACCAGCC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319537_1062319555 19 Left 1062319537 9:135984081-135984103 CCCTGCACCCCTGCTCAGCTACA 0: 1
1: 0
2: 2
3: 23
4: 226
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319532_1062319555 26 Left 1062319532 9:135984074-135984096 CCCCTCCCCCTGCACCCCTGCTC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319533_1062319555 25 Left 1062319533 9:135984075-135984097 CCCTCCCCCTGCACCCCTGCTCA 0: 1
1: 1
2: 8
3: 106
4: 1038
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319534_1062319555 24 Left 1062319534 9:135984076-135984098 CCTCCCCCTGCACCCCTGCTCAG No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319545_1062319555 -9 Left 1062319545 9:135984109-135984131 CCCTCCTGTCCTCAGAGGAGGAC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319543_1062319555 -5 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data
1062319540_1062319555 11 Left 1062319540 9:135984089-135984111 CCCTGCTCAGCTACAACCAGCCC No data
Right 1062319555 9:135984123-135984145 GAGGAGGACAGGGGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319555 Original CRISPR GAGGAGGACAGGGGAGGGGA AGG Intergenic