ID: 1062319556

View in Genome Browser
Species Human (GRCh38)
Location 9:135984135-135984157
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062319546_1062319556 2 Left 1062319546 9:135984110-135984132 CCTCCTGTCCTCAGAGGAGGACA No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319552_1062319556 -6 Left 1062319552 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319541_1062319556 22 Left 1062319541 9:135984090-135984112 CCTGCTCAGCTACAACCAGCCCT No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319543_1062319556 7 Left 1062319543 9:135984105-135984127 CCAGCCCTCCTGTCCTCAGAGGA No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319539_1062319556 24 Left 1062319539 9:135984088-135984110 CCCCTGCTCAGCTACAACCAGCC No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319540_1062319556 23 Left 1062319540 9:135984089-135984111 CCCTGCTCAGCTACAACCAGCCC No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319538_1062319556 30 Left 1062319538 9:135984082-135984104 CCTGCACCCCTGCTCAGCTACAA No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319548_1062319556 -1 Left 1062319548 9:135984113-135984135 CCTGTCCTCAGAGGAGGACAGGG No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data
1062319545_1062319556 3 Left 1062319545 9:135984109-135984131 CCCTCCTGTCCTCAGAGGAGGAC No data
Right 1062319556 9:135984135-135984157 GGAGGGGAAGGAGCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062319556 Original CRISPR GGAGGGGAAGGAGCTAAGTC AGG Intergenic