ID: 1062321416

View in Genome Browser
Species Human (GRCh38)
Location 9:135992339-135992361
Sequence CTCTGGGTAGGGTGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062321416_1062321427 -3 Left 1062321416 9:135992339-135992361 CCCTCTGGCCACCCTACCCAGAG No data
Right 1062321427 9:135992359-135992381 GAGGGTGAGGGACAGACCCTTGG No data
1062321416_1062321432 16 Left 1062321416 9:135992339-135992361 CCCTCTGGCCACCCTACCCAGAG No data
Right 1062321432 9:135992378-135992400 TTGGAGCTCAACTGGCCACAGGG No data
1062321416_1062321431 15 Left 1062321416 9:135992339-135992361 CCCTCTGGCCACCCTACCCAGAG No data
Right 1062321431 9:135992377-135992399 CTTGGAGCTCAACTGGCCACAGG No data
1062321416_1062321428 8 Left 1062321416 9:135992339-135992361 CCCTCTGGCCACCCTACCCAGAG No data
Right 1062321428 9:135992370-135992392 ACAGACCCTTGGAGCTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062321416 Original CRISPR CTCTGGGTAGGGTGGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr