ID: 1062324204

View in Genome Browser
Species Human (GRCh38)
Location 9:136004598-136004620
Sequence CTGTAACAGCAGAATCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062324189_1062324204 26 Left 1062324189 9:136004549-136004571 CCGCCTGGTGGGACAGGCACAGG No data
Right 1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG No data
1062324192_1062324204 23 Left 1062324192 9:136004552-136004574 CCTGGTGGGACAGGCACAGGGAA No data
Right 1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062324204 Original CRISPR CTGTAACAGCAGAATCAGGC CGG Intergenic
No off target data available for this crispr