ID: 1062324310

View in Genome Browser
Species Human (GRCh38)
Location 9:136004979-136005001
Sequence CTTGCAGCCCCGACAGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062324310_1062324315 -7 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data
1062324310_1062324327 17 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324327 9:136005019-136005041 AAGGATGGGGGACGGGGAATGGG No data
1062324310_1062324331 26 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324331 9:136005028-136005050 GGACGGGGAATGGGGGACAAGGG No data
1062324310_1062324320 4 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324320 9:136005006-136005028 AGGCGGCCGTGGGAAGGATGGGG No data
1062324310_1062324324 10 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324324 9:136005012-136005034 CCGTGGGAAGGATGGGGGACGGG No data
1062324310_1062324325 11 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324325 9:136005013-136005035 CGTGGGAAGGATGGGGGACGGGG No data
1062324310_1062324322 9 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324322 9:136005011-136005033 GCCGTGGGAAGGATGGGGGACGG No data
1062324310_1062324326 16 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324326 9:136005018-136005040 GAAGGATGGGGGACGGGGAATGG No data
1062324310_1062324330 25 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324330 9:136005027-136005049 GGGACGGGGAATGGGGGACAAGG No data
1062324310_1062324316 -6 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324316 9:136004996-136005018 TGCAAGGGCGAGGCGGCCGTGGG No data
1062324310_1062324328 18 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324328 9:136005020-136005042 AGGATGGGGGACGGGGAATGGGG No data
1062324310_1062324329 19 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324329 9:136005021-136005043 GGATGGGGGACGGGGAATGGGGG No data
1062324310_1062324332 30 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324332 9:136005032-136005054 GGGGAATGGGGGACAAGGGATGG No data
1062324310_1062324318 2 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324318 9:136005004-136005026 CGAGGCGGCCGTGGGAAGGATGG No data
1062324310_1062324317 -2 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324317 9:136005000-136005022 AGGGCGAGGCGGCCGTGGGAAGG No data
1062324310_1062324319 3 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324319 9:136005005-136005027 GAGGCGGCCGTGGGAAGGATGGG No data
1062324310_1062324321 5 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324321 9:136005007-136005029 GGCGGCCGTGGGAAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062324310 Original CRISPR CTTGCAGCCCCGACAGAAAC CGG (reversed) Intergenic
No off target data available for this crispr