ID: 1062324315

View in Genome Browser
Species Human (GRCh38)
Location 9:136004995-136005017
Sequence CTGCAAGGGCGAGGCGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062324303_1062324315 18 Left 1062324303 9:136004954-136004976 CCATGCAAGGCTCCTGATGCCTC No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data
1062324302_1062324315 19 Left 1062324302 9:136004953-136004975 CCCATGCAAGGCTCCTGATGCCT No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data
1062324310_1062324315 -7 Left 1062324310 9:136004979-136005001 CCGGTTTCTGTCGGGGCTGCAAG No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data
1062324305_1062324315 6 Left 1062324305 9:136004966-136004988 CCTGATGCCTCAGCCGGTTTCTG No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data
1062324309_1062324315 -1 Left 1062324309 9:136004973-136004995 CCTCAGCCGGTTTCTGTCGGGGC No data
Right 1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062324315 Original CRISPR CTGCAAGGGCGAGGCGGCCG TGG Intergenic
No off target data available for this crispr