ID: 1062324717

View in Genome Browser
Species Human (GRCh38)
Location 9:136006428-136006450
Sequence GGTCCCCCAGGGGCACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062324717_1062324727 12 Left 1062324717 9:136006428-136006450 CCTGAGGGTGCCCCTGGGGGACC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1062324727 9:136006463-136006485 TGCCTTCAATAGCCCAAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062324717 Original CRISPR GGTCCCCCAGGGGCACCCTC AGG (reversed) Intergenic
900146407 1:1160751-1160773 GCCCTCCCAGGGCCACCCTCAGG + Intergenic
900585466 1:3430492-3430514 AGTGCACGAGGGGCACCCTCAGG - Intronic
900592484 1:3466242-3466264 GGTCTCACTGGGGCACCCTGGGG + Intronic
901027597 1:6286874-6286896 GGTGCCCCTGGGGCACACTCAGG - Intronic
902410788 1:16210357-16210379 GACCCCCCAGAGGCCCCCTCAGG + Intronic
903182183 1:21610309-21610331 TCTCCCCCATGGGCCCCCTCTGG - Intronic
903266356 1:22160334-22160356 TGTCCGGCTGGGGCACCCTCAGG - Intergenic
903291191 1:22315325-22315347 TGTTCCCCAGGAGCACCCTTCGG - Intergenic
904497556 1:30895721-30895743 TGTCCCCAAGGGGAGCCCTCAGG + Intronic
905221532 1:36451104-36451126 GAGCCCCCAGGCGCATCCTCTGG - Intergenic
911188552 1:94926791-94926813 GGGGCCCCCGGGGCACCCTTGGG - Intronic
912908242 1:113730077-113730099 GGTCCCCCAGGCATTCCCTCAGG - Intronic
914717304 1:150263553-150263575 AATCCCCCGGGGGCACCCTGGGG - Intronic
915143013 1:153778519-153778541 GGACCCCCAGGGGCACTGTATGG + Exonic
915143469 1:153780711-153780733 AGTCCCCAGGGGGGACCCTCCGG + Intergenic
916346331 1:163795831-163795853 GGTACCACAGGGGCAGCCTAGGG - Intergenic
917674263 1:177304340-177304362 GGTCCCCAAGGGCCTCCCTGTGG - Intergenic
922198739 1:223382936-223382958 GGTTCCCCAGGGACAGCCTCAGG - Intergenic
922652811 1:227355695-227355717 GGTCTCCCAGGGTTACACTCTGG - Intergenic
1065943699 10:30587906-30587928 GGGCCCCTAGGGGCAGCCCCTGG + Intergenic
1067940581 10:50651592-50651614 AGTCCCCCAGGACAACCCTCAGG - Intergenic
1068827091 10:61452706-61452728 GGCACCCCAGGGCCACCCTAGGG - Intronic
1069486485 10:68827289-68827311 CTTCCCCCAGGGGCGCGCTCTGG - Intergenic
1070323393 10:75371788-75371810 GGTCTCCCAGGAGCAGCCTAAGG - Intergenic
1070802534 10:79251969-79251991 GGTCTCCCAGGAGCAGCATCAGG + Intronic
1071573771 10:86711654-86711676 GCTCCCCCCGGGGCCTCCTCCGG + Intronic
1071689236 10:87797962-87797984 GGTCACCCAGGGGCACCTTTTGG - Intronic
1071898162 10:90087273-90087295 GGTCACCCAGGGGTACCTTTTGG - Intergenic
1072225899 10:93368396-93368418 AGACTCCCAGGGGCACCCTGGGG - Intronic
1072656587 10:97334353-97334375 GGGCCCGCAGCGGCACCCCCGGG + Exonic
1073042249 10:100615621-100615643 GGCCCCGCTGGGGCACCCTGGGG + Intergenic
1073179447 10:101574982-101575004 TGCCCTCCAGGGGCAACCTCGGG + Intronic
1075806423 10:125192294-125192316 GGTCCCCCTGGGGCCCCACCAGG + Intergenic
1076368877 10:129939099-129939121 GGACACACAGGGGCACCTTCTGG - Intronic
1076593619 10:131609408-131609430 GGTCCCCCACGCTCAGCCTCCGG + Intergenic
1076919545 10:133444592-133444614 GGTCCCCCAGGGTCTCCCACAGG + Intergenic
1077254256 11:1573337-1573359 GGCCCCCCAGGGTCACCCTGGGG + Intergenic
1078019007 11:7640027-7640049 GCTCGCCCAGGGGGAGCCTCTGG - Intronic
1078098228 11:8313407-8313429 AGTCCCCCAGGGTCAGGCTCTGG + Intergenic
1081720005 11:45281767-45281789 GGTCACCCAGGGGACCTCTCTGG + Intronic
1081998151 11:47377752-47377774 GGGCCCACAGGGGTACCCACAGG - Intronic
1083618051 11:64036042-64036064 GGGCCCCCCTGGGCGCCCTCCGG + Intronic
1084149716 11:67282425-67282447 GCTCCCACAGGGGCACCCACGGG + Exonic
1090805403 11:130199125-130199147 GCACCTCCAGGTGCACCCTCTGG - Intronic
1091217739 11:133913618-133913640 GGTCCCTCAGGTGCACACACAGG + Intronic
1091659247 12:2370983-2371005 GGGACCCCAGGGGAACCATCTGG + Intronic
1092233168 12:6789158-6789180 GATACCCCTGGGGCACCCACTGG + Intronic
1092499462 12:9031150-9031172 GGTCACCCAGGGGCACCTTTAGG + Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1096571429 12:52525579-52525601 CCTCTCCCAGGGCCACCCTCAGG + Intergenic
1097572762 12:61355243-61355265 GGGCTCCCAGGGGCAGGCTCTGG - Intergenic
1099369396 12:81811631-81811653 CTCCCCCCAGGGGCTCCCTCTGG - Intergenic
1103714329 12:122935221-122935243 GGGCCCACAGGGTCACCCTCAGG - Intronic
1104981372 12:132574390-132574412 GGTGCCCCCGGGGCGGCCTCGGG + Exonic
1106761870 13:32875700-32875722 GGTCACCCAGATGCCCCCTCTGG + Intergenic
1107819231 13:44271363-44271385 CCTGCCCCAGGGGTACCCTCTGG + Intergenic
1113167841 13:107462971-107462993 GGTTCCCCAAGACCACCCTCAGG - Intronic
1113653352 13:112053672-112053694 AGTGCCCCAGGGGCCGCCTCCGG + Intergenic
1113924116 13:113930813-113930835 GGTCCTCCAGGGGCCCTCCCAGG + Intergenic
1114043587 14:18702296-18702318 GGTCCTCCAGGCGCACTGTCTGG + Intergenic
1114047869 14:18892738-18892760 GGTCCTCCAGGCGCACTGTCTGG + Intergenic
1114114649 14:19508905-19508927 GGTCCTCCAGGCGCACTGTCTGG - Intergenic
1114116346 14:19626668-19626690 GGTCCTCCAGGCGCACTGTCTGG - Intergenic
1116844456 14:49852510-49852532 GGACCCCCAGGGGTATCCTAAGG + Intronic
1118904080 14:70010834-70010856 AGTCCCCCAGGGGCACATTCAGG - Exonic
1119035981 14:71231064-71231086 GGGCTCCCAGGGGCAGGCTCTGG - Intergenic
1122203386 14:100136111-100136133 GGTCCCCCAGAGCCTCCCCCAGG + Intronic
1122488538 14:102097547-102097569 GTCCCCCCAAGGGCAACCTCTGG + Intronic
1122823606 14:104359214-104359236 GGGCCCCATGGGGGACCCTCTGG - Intergenic
1122881407 14:104692077-104692099 AGTCCCCGAGGGCCAGCCTCAGG + Intronic
1122937241 14:104965937-104965959 GCTCCCGCAGAGGCACCCCCAGG + Intronic
1125723621 15:41857008-41857030 GCTCCTGCAGGGGCTCCCTCAGG + Exonic
1125929971 15:43593620-43593642 GGTCTCCCGGGGGCAGCCGCGGG - Intronic
1125943139 15:43693452-43693474 GGTCTCCCGGGGGCAGCCGCGGG - Intronic
1126267617 15:46773212-46773234 GGTCACCCAAGGGCACCTTTCGG + Intergenic
1129034648 15:72641910-72641932 TCTCCCCCCGGGGCCCCCTCTGG + Intergenic
1129215234 15:74095306-74095328 TCTCCCCCCGGGGCCCCCTCTGG - Intergenic
1129732383 15:77939651-77939673 TCTCCCCCCGGGGCCCCCTCTGG - Intergenic
1131678051 15:94691623-94691645 GGTCCCACAGTGCCAACCTCTGG - Intergenic
1132600168 16:769607-769629 GGTACCCCAGGGGGGCCCACAGG + Exonic
1133303254 16:4795685-4795707 GGTCCCCCAGAGGCTGCATCAGG - Intronic
1133925656 16:10190096-10190118 GCACCCCCATGGGCACCATCTGG - Intergenic
1134098662 16:11436281-11436303 GGTTCCCGTGGGGCACTCTCTGG - Intronic
1135207963 16:20499074-20499096 GGGCTCCCAGGGGCAGGCTCAGG - Intergenic
1135210936 16:20524626-20524648 GGGCTCCCAGGGGCAGGCTCAGG + Intergenic
1136429139 16:30186839-30186861 GCTCCCGCAGGGGCAGCATCAGG - Exonic
1136577311 16:31132319-31132341 GGGCCCCCAGAGTCACCCTGAGG + Exonic
1136878891 16:33886219-33886241 GGTCCCCAGGGGGCCCCCTGGGG + Intergenic
1141592532 16:85078107-85078129 GGGACCCCGGGGGCTCCCTCTGG - Intronic
1141964459 16:87432532-87432554 GTACCCCTAAGGGCACCCTCAGG + Intronic
1203093129 16_KI270728v1_random:1229170-1229192 GGTCCCCAGGGGGCCCCCTGGGG - Intergenic
1143670515 17:8392978-8393000 GCTCCCCCAGGGGCATCCCGTGG + Exonic
1143871345 17:9959173-9959195 GGCTCCCGAGGGGCGCCCTCAGG - Intronic
1143983697 17:10893016-10893038 GGGTCCCCAGGACCACCCTCAGG - Intergenic
1144140333 17:12341537-12341559 GGTCCCCCAGCCCCACCCTGTGG - Intergenic
1145227357 17:21141212-21141234 GGTCACCCAGGGGTGCCTTCTGG + Intronic
1145786495 17:27597258-27597280 GGTCCTGCAGGAGCACCCTCCGG + Exonic
1147988196 17:44318460-44318482 GCTTCCCCAGGGGCTCCCTGTGG - Exonic
1150249233 17:63697097-63697119 TGTCCCACCGGGGCGCCCTCAGG + Exonic
1150624884 17:66835290-66835312 CGTCCCCCAGGGACCCCCCCAGG - Intronic
1151311212 17:73293463-73293485 GGCCTTCCAGGGGCAGCCTCTGG + Intronic
1151716759 17:75835045-75835067 GTTCACCCAGGGGCACCAGCTGG + Exonic
1151820413 17:76493918-76493940 GAACCCCCAGGGGCAGCTTCAGG + Intronic
1155638814 18:27987842-27987864 GGACCCCCAGGTGCAGACTCCGG - Intronic
1156296965 18:35801330-35801352 GGTTCCCCAGGGGCATCCAAGGG - Intergenic
1156462345 18:37328121-37328143 GGATCCCCAGAGGCAGCCTCAGG + Intronic
1158167126 18:54553460-54553482 GGTCACCCAGGGGCACCTTTTGG + Intergenic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1160888934 19:1366734-1366756 GGTAACCCAGGGGCAAACTCAGG - Intronic
1161046626 19:2138373-2138395 GGACCCCATGGGGCTCCCTCAGG + Intronic
1161338941 19:3730270-3730292 TGTCCCCCAGGGCCACCCGGGGG + Intronic
1161548284 19:4895745-4895767 GGCCCCACAGGGTGACCCTCAGG - Intronic
1161699077 19:5785174-5785196 GCTTTCCCAGGGGCACCCTGGGG - Exonic
1161847028 19:6718064-6718086 GCTTCCCCTGGGGCCCCCTCTGG + Intronic
1162052945 19:8046178-8046200 TGTCACCCTGGGGCACCCTGGGG + Intronic
1162140203 19:8580806-8580828 CGCCCCCCCGGGGCCCCCTCTGG + Exonic
1162851799 19:13436869-13436891 GGTGCCAAAGGGGCACTCTCAGG - Intronic
1164517725 19:28950124-28950146 GGTCTCCCATGGGCACCCTCGGG - Intergenic
1165153972 19:33776685-33776707 GGTCCCCCTGTGGGCCCCTCCGG + Intergenic
1167038455 19:47008198-47008220 GGGCCCCCAGGGTCTCTCTCTGG - Intergenic
1167244719 19:48365953-48365975 TGTCACCCAGGGGCACAGTCGGG - Intronic
1167269969 19:48501120-48501142 GCTCCCACAGGGTCACCCCCAGG + Exonic
1167449627 19:49559527-49559549 GGGCCCCCAAGGCCACCTTCAGG - Intronic
1167666573 19:50825932-50825954 GGTCCCCCAGAGTCACCCTGTGG + Exonic
1167705314 19:51078143-51078165 GGTCCCCCAGAGTCACCCTGAGG + Exonic
1168104854 19:54160428-54160450 TGTTCCCCAGGGGCCCTCTCAGG + Intronic
925217772 2:2111822-2111844 GGACCCCCAGGAGGACCCCCAGG - Intronic
925288399 2:2730540-2730562 CGTACCCCAGGGCCACGCTCAGG + Intergenic
925386092 2:3462811-3462833 GGCCTCCCAGGGGCACCCGGGGG - Intronic
926718221 2:15941085-15941107 CTTCCTCCAGGGGCACCCTTTGG - Intronic
927217281 2:20675110-20675132 GTGCCCCCAGAGGCAGCCTCAGG - Intergenic
927638963 2:24834885-24834907 GGTCCTGCAGGCGCAGCCTCCGG + Exonic
928695708 2:33847911-33847933 GGTCTCCCAAGGCCATCCTCTGG - Intergenic
929144278 2:38693030-38693052 GGCCACCCAGGGCCACCCTAGGG - Intronic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
932435192 2:71699257-71699279 GGTCAGGCAGGGGCACCCACTGG - Intergenic
932495589 2:72144424-72144446 GGAGGCCCAGGGGCACCCCCAGG + Intronic
938096956 2:128470597-128470619 GGACCCCCAAGTGCACCCACTGG + Intergenic
938425246 2:131181261-131181283 GGTCCTCCAGGCGCACTGTCTGG + Intronic
938968810 2:136412537-136412559 GGGCCCACAGAGGCAACCTCTGG - Intergenic
941666536 2:168247896-168247918 GGTCCCCAGGGGGCGTCCTCCGG - Exonic
942053651 2:172163058-172163080 GGGGCCCCAGGGGCAGGCTCTGG + Intergenic
944667740 2:201971222-201971244 GGGCCCCCAGGGGTACGCTCAGG + Intergenic
947169113 2:227293275-227293297 GGACTTCCAGGGGCTCCCTCAGG - Exonic
948597923 2:239092363-239092385 GTCCCCACAGGGGCAGCCTCGGG - Intronic
948684738 2:239663460-239663482 GCTCACTCAGGGGCAACCTCGGG - Intergenic
949000662 2:241610946-241610968 GGTCTCCGAGGGGGACTCTCAGG + Intronic
949027207 2:241771875-241771897 GCTCCCCCAGGGGCTCTCCCAGG - Intergenic
1169537404 20:6560101-6560123 GGTTCCCCAGGATCACCCTCAGG - Intergenic
1170999390 20:21397267-21397289 CGGCCCCCAGGGGCGCCCCCAGG + Exonic
1171150850 20:22825408-22825430 GGTGACCCAGGAGCACCCTGAGG - Intergenic
1171350803 20:24501837-24501859 GGTGCCCCAGGTGTACCCACTGG + Intronic
1171386182 20:24770733-24770755 GCTACCCCATGGGCACCATCAGG + Intergenic
1172136522 20:32690155-32690177 GGACCCCAAAGGGCACCCTTGGG + Intergenic
1175201900 20:57283783-57283805 GGTCCCCCAGTGGCACCTGAAGG + Intergenic
1175995223 20:62809304-62809326 GTTCCCCCAGAGGGACCTTCCGG + Intronic
1175998003 20:62819959-62819981 CGTTCCCCAGGGGCACCCTTGGG - Exonic
1177775591 21:25562419-25562441 AGTCCCCAGGGGGCACCCGCAGG - Intergenic
1179481630 21:41682157-41682179 GGGCCCCCAGCGCCAGCCTCTGG + Intergenic
1179802607 21:43818022-43818044 GGGCCCCCAGGGGCTGCCCCGGG + Intergenic
1179805060 21:43832230-43832252 GGGCCGCCAGGGGCTCCCACTGG - Intergenic
1179805693 21:43835662-43835684 GATCCTCCAGGGGCTCCCTGTGG - Intergenic
1179982405 21:44903220-44903242 GGTCCCCCCAGGGCATCCACAGG - Intronic
1180077800 21:45472034-45472056 GGCCCCTCGGGGGCACTCTCAGG + Intronic
1180466407 22:15615414-15615436 GGTCCTCCAGGCGCACTGTCTGG + Intergenic
1180998880 22:19978687-19978709 GTCTTCCCAGGGGCACCCTCTGG - Intronic
1181008828 22:20028452-20028474 GGTCACCCAGGAGCACATTCTGG - Intronic
1181048904 22:20229525-20229547 GGACCCCCAGGGCCACCCGCAGG + Intergenic
1181645818 22:24231453-24231475 AGTCCCCCAGGGGCACCTCCAGG + Exonic
1181946976 22:26525614-26525636 GGGTCCCCAGGGCCACCCCCAGG - Exonic
1182558169 22:31140294-31140316 AGCCCCCCAGGGCCACCCCCAGG + Exonic
1183195771 22:36352482-36352504 GGCAGCCCATGGGCACCCTCAGG + Intronic
1184369856 22:44075431-44075453 GGTACCACAGATGCACCCTCTGG - Intronic
1184496891 22:44847159-44847181 GGCCCCCCAAGGGCAGGCTCAGG + Intronic
949888180 3:8712799-8712821 GGGCCCCCAGGGGCTGCCTGGGG - Intronic
950103769 3:10375462-10375484 CGTGCCCGAGGGGCTCCCTCTGG - Exonic
950704981 3:14773882-14773904 TGTCCCTCACAGGCACCCTCAGG - Intergenic
954294056 3:49664449-49664471 GGAACCCCAGGGGCTCCCGCCGG + Exonic
954360822 3:50121940-50121962 TGACCCCCAGGGACCCCCTCTGG + Intergenic
954377289 3:50201902-50201924 GGGCCCTCAGGGGCACCTTGAGG - Intergenic
958985644 3:100776897-100776919 GGCCCCCAAGTGGCACACTCAGG + Intronic
961385568 3:126521595-126521617 GGTCTCCTTGGGCCACCCTCTGG - Intergenic
961448778 3:126993084-126993106 TGTGCCCCAGGGGCACCGTTTGG + Intronic
961452516 3:127008812-127008834 TGGCCCCCAGCGTCACCCTCTGG + Intronic
962820554 3:139044395-139044417 CGTCCTCCAGGGGCACACGCAGG + Exonic
963047583 3:141114244-141114266 GCTCCCCCAGGGCCATGCTCAGG - Intronic
965571924 3:170181619-170181641 GTTCCCCCAGGGGAAAGCTCAGG - Intronic
968486797 4:866812-866834 CCTCCCCCAGGAGCAGCCTCGGG - Intronic
968510441 4:993198-993220 GGTTTCTTAGGGGCACCCTCAGG - Intronic
969498049 4:7537299-7537321 GGTCTCCCAGGGCGATCCTCTGG + Intronic
975065932 4:70063716-70063738 GGTCACCCAGGGGCACCTTTCGG + Intergenic
977401811 4:96542095-96542117 AGTCCCCCAGGTGAACTCTCAGG + Intergenic
977500344 4:97829136-97829158 CGTCCCAGAGGGGCACCCACCGG - Intronic
978761669 4:112359813-112359835 GGGCCTCCATGGGCACCCACTGG - Intronic
985773207 5:1825719-1825741 GGTCCTCCAGGGGCCACCTGGGG + Intergenic
988686922 5:33534403-33534425 GGTCCCCCAGAAGCAGGCTCTGG - Intronic
990186156 5:53212169-53212191 GGTCACTCAGGGGCACCTTTCGG + Intergenic
990449070 5:55918591-55918613 GGTCACTCAGTGGCATCCTCTGG + Intronic
990494840 5:56337130-56337152 TGTACCTGAGGGGCACCCTCTGG - Intergenic
991720777 5:69492937-69492959 GTCCCCCCACGGGGACCCTCGGG - Intronic
992540142 5:77756399-77756421 GGTCACTCAGAGGCACCTTCTGG + Intronic
995856744 5:116600724-116600746 GGTCCTCCAGTGGCTCACTCAGG - Intergenic
998137829 5:139683749-139683771 GGTCCCCAGGGGGCCCCCTGCGG + Exonic
999696332 5:154190972-154190994 GATCCCCCAGGGGTGCCGTCGGG - Exonic
1002440184 5:179260251-179260273 GGTCGCCCAGGAGCTCACTCCGG - Intronic
1003160927 6:3633632-3633654 GGCCCCCCATGTCCACCCTCAGG - Intergenic
1005881965 6:30068966-30068988 GCTTCCCCAGGCCCACCCTCTGG - Intronic
1006297796 6:33177733-33177755 GGTCCCTCCGGGCCACCTTCAGG - Intronic
1006358370 6:33573778-33573800 GGACCCCAAAGGGCACCCTTGGG + Exonic
1006452060 6:34110990-34111012 GGCTCCCCATGGGCACCCTCAGG + Intronic
1006841040 6:37027998-37028020 TGGGCCCCAGGGGGACCCTCGGG + Exonic
1007590210 6:43016478-43016500 GGTCACCCAGGGCCCCCCACAGG - Intronic
1007713306 6:43838501-43838523 GGGACCCCAGGGGCAGCCTGGGG - Intergenic
1010634302 6:78238754-78238776 GGTCCCCAAGGGGCAACTTCTGG + Intergenic
1011708822 6:90030255-90030277 GGACCCTCAATGGCACCCTCAGG + Intronic
1013286895 6:108689618-108689640 GCTCACCCAGGGGCACCCGAGGG - Intergenic
1013964295 6:115936105-115936127 CGTCCCAGAGGGGCACCCACTGG - Exonic
1015968765 6:138722227-138722249 GGTCACCCAGGGGCTAACTCAGG + Intergenic
1017605792 6:156131447-156131469 TGTTCCCCAGGGTCACCCTGTGG + Intergenic
1017819741 6:158040789-158040811 CGTCACTCAGGGTCACCCTCTGG + Intronic
1019334642 7:477190-477212 CTTCTCCCAGGGGCACCCACCGG - Intergenic
1019497119 7:1345884-1345906 GGGACCCCAGTGACACCCTCTGG - Intergenic
1022008815 7:26291718-26291740 GGTGCTCCAGCGGCACCCTTCGG - Intergenic
1024888012 7:54166929-54166951 AGTCTCCCAGGGGCACCTTTTGG + Intergenic
1027212805 7:76164525-76164547 CGTCCCCCCGCGGCCCCCTCCGG - Intergenic
1027316762 7:76990475-76990497 GCTCCCCCAGGGAGCCCCTCTGG - Intergenic
1034458732 7:151186530-151186552 CGGCCCCCAGGGGCACTGTCTGG + Exonic
1035022297 7:155806902-155806924 GACCCTCCAGGGGCACCCTCTGG + Intronic
1035323652 7:158050972-158050994 GGTCACCCAGGGGCACGCCATGG + Intronic
1038612656 8:29069987-29070009 GGTCCCCCAGAGGCACTTTGCGG + Exonic
1038961517 8:32525292-32525314 AGTGCCACAGGGGCAGCCTCAGG - Intronic
1039395385 8:37221075-37221097 AGACTCCCAGGGGCTCCCTCTGG + Intergenic
1039606353 8:38884047-38884069 AGACCCTCAGGGGCTCCCTCGGG + Intergenic
1042894412 8:73651168-73651190 GGGCCCCGAGGAGCCCCCTCAGG + Intronic
1043677345 8:82973790-82973812 GGTCACCCAGGGGCACCTTAAGG + Intergenic
1048975815 8:139672591-139672613 GCTCCCCTGGGGGCAGCCTCAGG - Intronic
1049473595 8:142786990-142787012 GGACACCCACGGGCACCCACAGG - Intergenic
1049522668 8:143102254-143102276 GGCACCCCAGGGGGCCCCTCAGG - Intergenic
1054351462 9:64020763-64020785 GCTCCACCAGGGTGACCCTCAGG + Intergenic
1054932871 9:70654291-70654313 AGTCACCCAGGGGCACCTTTTGG - Intronic
1056750408 9:89346792-89346814 GCTCGCCCAGGGGCTGCCTCAGG - Intronic
1056763738 9:89432083-89432105 GGTGGCCCAGCTGCACCCTCTGG + Intronic
1057157838 9:92859706-92859728 GGGTCCCCAGGACCACCCTCAGG + Intronic
1057183098 9:93040313-93040335 GGTTCCCCAGGGGCACCTGGTGG + Intergenic
1057819812 9:98322153-98322175 GGTGCCCCTGGTGCCCCCTCTGG - Intronic
1059382050 9:113934341-113934363 GGTGCCCCAGGCCCAGCCTCAGG + Intronic
1059418762 9:114178285-114178307 GGTAGCCCAGGGGGACCCTGAGG - Exonic
1059770020 9:117415402-117415424 GCGCCCCCAGGTGCAGCCTCTGG - Intergenic
1061933412 9:133844880-133844902 GGGCCCTCATGGGCACCGTCGGG - Intronic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1062324717 9:136006428-136006450 GGTCCCCCAGGGGCACCCTCAGG - Intergenic
1185461373 X:334123-334145 GTTCCCACACGGACACCCTCTGG - Exonic
1188904736 X:35778607-35778629 AGTCACCCAGGGGCACCTTTTGG + Intergenic
1189551033 X:42094063-42094085 GGTCACCCAGGGGCACCTTTTGG + Intergenic
1192995225 X:76505888-76505910 GGTCTCCCAGTGGATCCCTCTGG + Intergenic
1195861595 X:109388979-109389001 GCTCCCCCATGGACACCCTAGGG - Intronic
1200071259 X:153530618-153530640 GGTCCCCAAGGTGGCCCCTCCGG + Intronic
1201153274 Y:11107026-11107048 GCTCCACCAGGGTGACCCTCAGG + Intergenic