ID: 1062328445

View in Genome Browser
Species Human (GRCh38)
Location 9:136023958-136023980
Sequence GCATGTGCACGTGTGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1143
Summary {0: 1, 1: 3, 2: 31, 3: 154, 4: 954}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062328445_1062328456 30 Left 1062328445 9:136023958-136023980 CCCCCACACACACGTGCACATGC 0: 1
1: 3
2: 31
3: 154
4: 954
Right 1062328456 9:136024011-136024033 TGCCAGCTGTGAGTTCCTCTGGG No data
1062328445_1062328452 2 Left 1062328445 9:136023958-136023980 CCCCCACACACACGTGCACATGC 0: 1
1: 3
2: 31
3: 154
4: 954
Right 1062328452 9:136023983-136024005 CAGACATGGAGGAAGCTCCCGGG No data
1062328445_1062328455 29 Left 1062328445 9:136023958-136023980 CCCCCACACACACGTGCACATGC 0: 1
1: 3
2: 31
3: 154
4: 954
Right 1062328455 9:136024010-136024032 GTGCCAGCTGTGAGTTCCTCTGG No data
1062328445_1062328451 1 Left 1062328445 9:136023958-136023980 CCCCCACACACACGTGCACATGC 0: 1
1: 3
2: 31
3: 154
4: 954
Right 1062328451 9:136023982-136024004 TCAGACATGGAGGAAGCTCCCGG No data
1062328445_1062328450 -9 Left 1062328445 9:136023958-136023980 CCCCCACACACACGTGCACATGC 0: 1
1: 3
2: 31
3: 154
4: 954
Right 1062328450 9:136023972-136023994 TGCACATGCGTCAGACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062328445 Original CRISPR GCATGTGCACGTGTGTGTGG GGG (reversed) Intronic
900137413 1:1123964-1123986 GCATGTGCGCAGGTGTGTGCAGG - Intergenic
900187858 1:1340818-1340840 GTGTGTGCAGGTGTGTGTGCAGG - Intronic
900222889 1:1518731-1518753 GACTGTGCCCATGTGTGTGGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900526022 1:3129042-3129064 TCTGGTGCATGTGTGTGTGGGGG + Intronic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900974658 1:6009436-6009458 GCATCTGAAGGTGTGTGTGCAGG - Intronic
901205492 1:7492858-7492880 GCATGTGCGCGTGTGTTTGTAGG - Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901297790 1:8173903-8173925 GTATGTGCACGTATGTGTGCAGG - Intergenic
901815429 1:11790912-11790934 GCATGTGTGCGTGTGTGCGGGGG - Intronic
902625924 1:17676321-17676343 GTATGTTCACGTGTGGGTGCAGG + Intronic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903065074 1:20695085-20695107 GCATGTGCATGTGTGCCTGAGGG - Intronic
903372468 1:22845721-22845743 GTCTGTGTACGTGTGTGTGTGGG - Intronic
903668079 1:25020016-25020038 GTATGTGAATGTGTGTGTGCAGG - Intergenic
903668085 1:25020102-25020124 GTATGTGAATGTGTGTGTGCAGG - Intergenic
903668089 1:25020242-25020264 GCATGTGCATGTGTATGTGCAGG - Intergenic
904291254 1:29487409-29487431 GCATGTGTGCATGTGTGTGGAGG - Intergenic
904329274 1:29747348-29747370 ATATGTGCATGTGTGTGTGAAGG - Intergenic
904470833 1:30735239-30735261 ACATGTTCAAGTGCGTGTGGCGG - Exonic
904563701 1:31414613-31414635 GCGTGTGCATGTGCGTGTGCAGG + Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905867843 1:41385929-41385951 GTGTGTGCGTGTGTGTGTGGTGG + Intergenic
906343958 1:45003783-45003805 GCACATGTACGTGTGTGGGGAGG + Intronic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
907552610 1:55317050-55317072 GCATGTGTGTGTGTGTGTGTGGG + Intergenic
907788508 1:57637465-57637487 GTATATGCAGGTGTGTGTAGGGG + Intronic
907919858 1:58902458-58902480 GCATGTGTGCTTGTGTGTTGAGG + Intergenic
908153704 1:61330440-61330462 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
908696308 1:66845838-66845860 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
909418597 1:75435856-75435878 GTGTGTGTATGTGTGTGTGGTGG - Intronic
909467415 1:75988398-75988420 GAATGTGGAGGTGTGTGTGAGGG + Intergenic
909467464 1:75989055-75989077 GAATGTGGAGGTGTGTGTGAGGG - Intergenic
910395772 1:86792394-86792416 GGATATGCATGTGTGTGTGCTGG - Intergenic
911817375 1:102369928-102369950 TCATGTGCATATGTGTGTGGAGG + Intergenic
912451024 1:109767905-109767927 GCATGTGTATGTGTATGTGGCGG + Intronic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
916205372 1:162311202-162311224 GAATGTGCTGGTGTGTTTGGAGG - Intronic
916652208 1:166842840-166842862 GTATGTGTGTGTGTGTGTGGTGG - Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
917567238 1:176225425-176225447 GCACGTGCATATATGTGTGGTGG + Intergenic
918674573 1:187266943-187266965 TCATGTGTATGTGTGTTTGGAGG - Intergenic
919977534 1:202622652-202622674 GCTTGTGCAGCTGTGTGTGGGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920691473 1:208150191-208150213 GCATGTGCGTGTGTGTGTAAGGG - Intronic
920868247 1:209771054-209771076 GCATGTGGAGGTGTGTGTGCAGG + Intronic
920868288 1:209771493-209771515 GCATGTGAAGGTGTGTGTGAAGG + Intronic
920868303 1:209771655-209771677 GCATGTGAAGGTGTGTGTTCAGG + Intronic
921254536 1:213327597-213327619 GCATGTGTATGTGTGTGTTTTGG + Intergenic
921291743 1:213664036-213664058 GCATCTGCACATGGGTGAGGTGG - Intergenic
921866194 1:220090204-220090226 GGAGGTGGAGGTGTGTGTGGTGG - Intronic
921973188 1:221173470-221173492 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
922085615 1:222344216-222344238 GTATGTGTACGTGTGTGTGATGG + Intergenic
922540159 1:226413009-226413031 GCTGGTGTATGTGTGTGTGGTGG + Intergenic
922720728 1:227899054-227899076 GCATGAGAACGTGTGTGTGCAGG - Intergenic
922746404 1:228046744-228046766 GCATGTGTGCTTGTGTGTGGTGG + Intronic
923664892 1:235991128-235991150 GCATGCGTGCATGTGTGTGGGGG - Intronic
923968343 1:239169847-239169869 GTATGTGCATGTCTGTGTGTTGG - Intergenic
924202428 1:241674035-241674057 GCACATGCACGTGTGTGTGTAGG + Intronic
924528721 1:244875189-244875211 ACATGTGAATGTTTGTGTGGGGG - Intergenic
924567068 1:245207766-245207788 CGATGTGTACGTGTGTTTGGGGG - Intronic
924691198 1:246352550-246352572 GTATGTGTTTGTGTGTGTGGAGG - Intronic
924861221 1:247924683-247924705 GCATGTGTATATGTGTGGGGTGG - Intergenic
924940570 1:248810497-248810519 GCATGTGCTGGTGTGTAAGGGGG - Exonic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062901544 10:1150398-1150420 GCATGTGTACACGTGTGTGATGG - Intergenic
1062906466 10:1182968-1182990 GCATGTGCCCCTGGGTGTGGGGG + Exonic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063033376 10:2258945-2258967 GCATGTGTGCCTGTGTGTGTTGG - Intergenic
1063158285 10:3399593-3399615 GCGTGTGCATGTGTGCGTGCGGG + Intergenic
1063991033 10:11563403-11563425 GTATGTGTGTGTGTGTGTGGTGG - Intronic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064120692 10:12615896-12615918 GCATGTGCTGGTGTGTGTATAGG + Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1065412487 10:25444470-25444492 GGAGGTGCATGTATGTGTGGGGG + Intronic
1065574023 10:27100484-27100506 GCATGCGCACTTGTGTCTAGCGG - Exonic
1065701409 10:28429526-28429548 GTGCGTGCATGTGTGTGTGGGGG + Intergenic
1065876325 10:30000366-30000388 ACCTGGGCACCTGTGTGTGGAGG - Intergenic
1066184235 10:32993610-32993632 GGATGTGTATGTGTGTGTAGTGG + Intronic
1066194708 10:33087930-33087952 GCATGTCTATATGTGTGTGGTGG + Intergenic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1066581740 10:36889207-36889229 GTACGTGCATTTGTGTGTGGGGG + Intergenic
1067189407 10:44057051-44057073 GCAAGTGCACTTGTGGTTGGAGG - Intergenic
1067683006 10:48451957-48451979 GTGTGTGCAATTGTGTGTGGCGG - Intronic
1067711561 10:48655239-48655261 GGATGTGTGTGTGTGTGTGGGGG + Intronic
1067833295 10:49622396-49622418 ACCTGTGCACGTATGTGTGGAGG - Intronic
1068059531 10:52050051-52050073 GTGTGTTCATGTGTGTGTGGTGG + Intronic
1068530368 10:58179230-58179252 AAATGTGCATGTTTGTGTGGGGG + Intergenic
1069289709 10:66763043-66763065 GTATGTGCATGTCTGTGGGGTGG + Intronic
1069610312 10:69768408-69768430 GCATGTGAATGTATGTGTGAGGG + Intergenic
1069863183 10:71483887-71483909 GCACAGGCACATGTGTGTGGGGG - Intronic
1069953318 10:72034478-72034500 ACACGTGCATGTGTGTGTGGAGG - Intergenic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1071513865 10:86284269-86284291 GTGTGTGCAAGTGTGTGTGATGG - Intronic
1071563394 10:86659535-86659557 GCTGGTGCAGGTGTGAGTGGTGG - Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1073003470 10:100303024-100303046 GCACACGCACATGTGTGTGGAGG + Intronic
1073007238 10:100333990-100334012 GCAGGTGCATGTGTGTGGGATGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1073185454 10:101612802-101612824 GCATGTGCATGTGAATGTGAGGG - Intronic
1073475068 10:103747325-103747347 CCATGTGGGCGTGGGTGTGGTGG + Intronic
1074227484 10:111499936-111499958 ATGTGTGCATGTGTGTGTGGGGG + Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075033121 10:119040444-119040466 ACAAGTGCACGTGTATGTGATGG + Intronic
1075090771 10:119443056-119443078 GCATCAGCACGTATGTCTGGAGG - Intronic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075226527 10:120634413-120634435 TCGTGTGTACGTGTGTGTGACGG - Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654895 10:124154755-124154777 GAATGTGCATGTGAGTGTGGGGG - Intergenic
1075825448 10:125353681-125353703 ACATGTGAAGGTATGTGTGGGGG + Intergenic
1076054709 10:127362862-127362884 GGATGTGTATGTGTGTGTGTGGG - Intronic
1076054726 10:127362990-127363012 GGATGTGCGTGTGTGTGTGGGGG - Intronic
1076139326 10:128067041-128067063 GCATGTGCATGCATGTGTGTGGG - Intronic
1076194789 10:128509810-128509832 GCATGAGCGTGTGTTTGTGGGGG - Intergenic
1076342678 10:129760241-129760263 ACACGTGCCTGTGTGTGTGGGGG + Intronic
1076422027 10:130338589-130338611 GTATGTGCGTGTGTGTGTGGGGG + Intergenic
1076461134 10:130648464-130648486 GCATGTGCACATGTGTGTGCAGG + Intergenic
1076519538 10:131072797-131072819 GTATGTGTATGTGTGTGTGCAGG - Intergenic
1076591572 10:131587209-131587231 GCAAGTGAAGGTGAGTGTGGGGG + Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076729313 10:132430391-132430413 ACATGTGCCAGTGTGTGTGTTGG + Intergenic
1076778815 10:132712726-132712748 GCATGTGTAGGTGTGTGTGTAGG + Intronic
1076778870 10:132713144-132713166 GCATGTGTATGTGTGTGTGCGGG + Intronic
1077090099 11:774497-774519 GCTTCTGCACGTGTGTGAGGAGG - Intronic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077340402 11:2023913-2023935 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1077489549 11:2854353-2854375 GTATGTGTAGGTGTGTGTAGGGG - Intergenic
1077529308 11:3087759-3087781 GCCTATGCATCTGTGTGTGGGGG + Exonic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078337380 11:10474804-10474826 CCAGGTGCAAGTGTGGGTGGGGG + Intronic
1078355186 11:10627596-10627618 GCATGCACACGTATGAGTGGAGG - Intronic
1078498571 11:11844797-11844819 GCATGTGTGCGTGCGTGTGTTGG + Intronic
1078800682 11:14642090-14642112 GCATGTGCGTGTATGTGTGTGGG - Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079004438 11:16782172-16782194 GGATGAGAACGTGTGTGTGTGGG - Intronic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079629580 11:22657542-22657564 GCATGTGAGTGTGTGTGAGGGGG - Intronic
1080034351 11:27697118-27697140 GCACGTGCGCGTGTGTGTAGAGG - Intronic
1080138779 11:28890523-28890545 ATATGTGCATGTGTGTGTGCAGG + Intergenic
1080305311 11:30828709-30828731 GCATGTGTGTGTGTATGTGGTGG - Intergenic
1080397612 11:31904304-31904326 GCCTGTGCTCCTGTCTGTGGAGG + Intronic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1081049695 11:38322965-38322987 GCGTGTGTGTGTGTGTGTGGTGG + Intergenic
1081408168 11:42722376-42722398 GCATGTGTGTGTGTGTGTGGTGG - Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081994925 11:47357982-47358004 GTGTGAGCAGGTGTGTGTGGGGG - Intronic
1082713040 11:56577927-56577949 GAATGTGCCTGTGTGTGTGTGGG - Intergenic
1083257176 11:61503805-61503827 GCATGTGTATGTGTGTGTGTTGG - Intergenic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084477933 11:69399386-69399408 GCATGTGTGCATGTGTGTGTAGG + Intergenic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084665370 11:70573526-70573548 CCATGTGTCTGTGTGTGTGGGGG + Intronic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1086088849 11:82984632-82984654 GTATGTGTGCATGTGTGTGGTGG - Intronic
1086806316 11:91247249-91247271 ACGTTTGCATGTGTGTGTGGAGG + Intergenic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1087032463 11:93719206-93719228 AGATGTGTACGTGTGTGTGTGGG + Intronic
1087400135 11:97654674-97654696 GCAGCTGCATGTGTATGTGGTGG + Intergenic
1088849330 11:113692480-113692502 CCACATGCACGTGTGTGTCGGGG + Intronic
1088884282 11:113994775-113994797 GCATGGGCACAGGTGTGTGATGG - Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089292822 11:117448621-117448643 GAATGTGTGTGTGTGTGTGGGGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1090635282 11:128687106-128687128 GCATGTGGGCGTGTGTATGTGGG + Intronic
1090763218 11:129855102-129855124 GAATATGCACGTGTGTGAGCAGG - Intronic
1091150741 11:133326334-133326356 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1091220176 11:133926027-133926049 ACATGTGCACAGGAGTGTGGGGG - Intronic
1091224461 11:133949311-133949333 GCGTGCGCATGTGTGTGTGAAGG - Intronic
1091303488 11:134522941-134522963 GCAGGTGCAAGTGTGAGTGCGGG - Intergenic
1202823387 11_KI270721v1_random:79102-79124 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1091463542 12:664235-664257 GCTTGTGCAGGTGTGGGTGTGGG + Intergenic
1091705517 12:2690755-2690777 GCACGTGTACGTGTGTGTGTTGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091734453 12:2908011-2908033 GCACCTGCACGTCTGTGTGAGGG + Intronic
1092262291 12:6959208-6959230 GTGTGTGAATGTGTGTGTGGCGG - Intronic
1092284717 12:7122100-7122122 GTATGTGTGTGTGTGTGTGGTGG + Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092496065 12:8996159-8996181 GCATGTGTGTGTGTGTGTGGTGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092940507 12:13403193-13403215 GCATGTGCATATGTGTGTGGGGG + Intergenic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1093253110 12:16832706-16832728 GCACATGCATGTGTGTGTTGGGG + Intergenic
1093878189 12:24374496-24374518 GTATGTGTGTGTGTGTGTGGTGG - Intergenic
1094221526 12:27998827-27998849 GCAGGTGCAAGTGTGTTTGAGGG - Intergenic
1095438640 12:42219619-42219641 GTGTGTGCATGTGTGTGTGCAGG - Intronic
1095559995 12:43552660-43552682 GCATGGGCCCCTGTGTGTGCTGG + Intergenic
1095618772 12:44224145-44224167 GGTTGTGCATGTGTGTGTGTGGG - Intronic
1095662620 12:44755357-44755379 GCATGTGCGTGTGTGTATGTAGG - Intronic
1095814538 12:46406993-46407015 ACATGTGCAAGTGGGTGGGGAGG - Intergenic
1095827742 12:46547836-46547858 GCATGTGCTTGTGTGTGAGGAGG + Intergenic
1096341033 12:50799381-50799403 GCATGTGCATGTGTGTATTTGGG - Intronic
1096476283 12:51911122-51911144 GCATGTGCAGGTGTGTGTCTGGG - Intronic
1096558096 12:52416272-52416294 GTGTATGCATGTGTGTGTGGGGG + Intergenic
1097177486 12:57151809-57151831 GTATGTGCGTGTGTGTGTGGTGG + Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1099407100 12:82277853-82277875 GAATGTGTATGTGTGTGTGTAGG + Intronic
1100000264 12:89826119-89826141 GCACGTGCATGTATGTGTGCAGG - Intergenic
1100700506 12:97142752-97142774 ATATGTGTACGTGTGTGTGTGGG + Intergenic
1100727601 12:97425431-97425453 GTATGTGCATGTATGTGTGTGGG - Intergenic
1101144247 12:101826355-101826377 GTATGTGTATCTGTGTGTGGGGG - Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102464271 12:113119384-113119406 CCATTTGCACGTGTGTTTTGGGG - Exonic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102746413 12:115252877-115252899 GCATTTGCGTGTGTGTGTGTTGG + Intergenic
1102825795 12:115946998-115947020 GCACGTGTATGTGTGTGAGGAGG - Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103197907 12:119061317-119061339 GCGTGTGCACTTGGGTGTGTTGG + Intronic
1103427870 12:120853963-120853985 GTATGTGTGCGTGTGTGTGGTGG - Intronic
1104200902 12:126587806-126587828 GTCTGTGCACCTGGGTGTGGTGG - Intergenic
1104259440 12:127169449-127169471 GTTTGTGCAGGTGTGGGTGGAGG - Intergenic
1104405382 12:128512222-128512244 GCAGGTGCACGGGGATGTGGGGG - Intronic
1104470356 12:129025097-129025119 GGATGTGGAGGTGTGTGTGTGGG - Intergenic
1104759893 12:131290804-131290826 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759894 12:131290816-131290838 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759895 12:131290828-131290850 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104761989 12:131302340-131302362 GCCTTTTCACTTGTGTGTGGTGG - Intergenic
1104820829 12:131676332-131676354 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820830 12:131676344-131676366 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820832 12:131676366-131676388 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104980531 12:132571419-132571441 GCGTGTGCTGGTGTGTGTGCTGG - Exonic
1105692653 13:22857639-22857661 GCATGTGTGTGTGTGTGTAGTGG - Intergenic
1105962217 13:25352535-25352557 GTATGTGCACATGTGTGAGGGGG + Intergenic
1106136195 13:26975588-26975610 GTGTGTGTAGGTGTGTGTGGGGG - Intergenic
1106310570 13:28550406-28550428 GTATGTGTGTGTGTGTGTGGGGG + Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106876446 13:34079041-34079063 GCATGTGTATGTGAGTGTGTGGG + Intergenic
1107022133 13:35763035-35763057 GCATGTGTAGGTGTGTGTGTAGG - Intergenic
1107272703 13:38638827-38638849 GCATATGCACATGCTTGTGGGGG - Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1107567726 13:41623172-41623194 GTATGTGTATGTGTGTGTGTTGG - Intronic
1107658792 13:42617953-42617975 GCATGTGCATGTGTGTTTAATGG + Intergenic
1107892359 13:44925238-44925260 GCCTTTGCACTTGTGTGGGGAGG + Intergenic
1108476367 13:50822023-50822045 ACATGTGCATGAGTGTGTGTAGG - Intronic
1108918381 13:55644351-55644373 GCATGTGCACGTGGGGGAGACGG - Intergenic
1109276465 13:60309552-60309574 GCATGCTCACTTGTGTGTGCAGG + Intergenic
1109417171 13:62055928-62055950 GTGTGTGTATGTGTGTGTGGTGG - Intergenic
1110205543 13:72908691-72908713 AGTTGTGCATGTGTGTGTGGGGG - Intronic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1110408619 13:75179115-75179137 GCATGTGTGTGTGTGGGTGGGGG + Intergenic
1111076244 13:83239806-83239828 GTGTGCGCATGTGTGTGTGGTGG - Intergenic
1111558801 13:89916322-89916344 GTATGTGTCTGTGTGTGTGGTGG + Intergenic
1112262831 13:97893160-97893182 GCATGTGTGCCTGTGTGTGCAGG + Intergenic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112503154 13:99957363-99957385 GCGCGTGAGCGTGTGTGTGGGGG + Intergenic
1112565701 13:100549825-100549847 GTATGTGCTCATGTGTGTTGGGG - Intronic
1112944828 13:104915370-104915392 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1113396834 13:109955704-109955726 GTATCTTCATGTGTGTGTGGTGG - Intergenic
1113573895 13:111381425-111381447 GCAGATGAAGGTGTGTGTGGAGG + Intergenic
1113598931 13:111554654-111554676 GGGTGTGAACGTGTGTGGGGAGG - Intergenic
1113791620 13:113031991-113032013 ACATGTGCAGGTCTGTGGGGGGG - Intronic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113874126 13:113584196-113584218 GCATGTGCACGTGAGGGAGCGGG - Intergenic
1113901366 13:113800154-113800176 GTATGTGTATGTGTGTGTGGAGG + Intronic
1113957111 13:114104916-114104938 TCAGGTGAACGTGTGTGGGGAGG - Intronic
1113963943 13:114141306-114141328 GTGTGTGCATGTGTGTGTGAGGG - Intergenic
1114431089 14:22661366-22661388 GCATGTGTGTGTGTGTGTGTGGG - Intergenic
1114692805 14:24600834-24600856 GCATGTGCATATGTTAGTGGTGG + Intergenic
1115041617 14:28937533-28937555 GTATGTGAATGTGTGTGTGTGGG + Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1115784368 14:36807516-36807538 TCATGTGGAAGTGTGGGTGGGGG - Intronic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1116640218 14:47452184-47452206 GTATGTGTAAGTTTGTGTGGTGG - Intronic
1117538574 14:56724917-56724939 AAATGTGTATGTGTGTGTGGGGG - Intronic
1117971713 14:61257630-61257652 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
1118181035 14:63493486-63493508 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
1118323333 14:64765857-64765879 GTATGTGTGTGTGTGTGTGGAGG + Intronic
1118764202 14:68899247-68899269 GCATGTGGGTGTGTGTGTGAAGG - Intronic
1118917048 14:70116359-70116381 GTGTGTGCACGTTTGTGTGCAGG + Intronic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1119408645 14:74414240-74414262 GCACGCACACGTGTGTGTGTAGG + Intronic
1119519286 14:75273924-75273946 GCATGTGTGTGTGTGTGGGGGGG + Intergenic
1119738838 14:77000772-77000794 GCGTGTGCAAGTGTGTCTGCAGG - Intergenic
1120120388 14:80672512-80672534 GCATGTGTGCATGTGTGTGTAGG + Intronic
1120464834 14:84843139-84843161 GTATGTGCACATATATGTGGGGG + Intergenic
1120636385 14:86956594-86956616 GCACATGCTTGTGTGTGTGGGGG + Intergenic
1120771286 14:88383176-88383198 GCATGTTGAAGTGTGTGTGATGG - Intergenic
1121548806 14:94782637-94782659 GCATGTGTGTCTGTGTGTGGGGG + Intergenic
1121656584 14:95601511-95601533 GCATGTGTGCATGTGTGTGTGGG + Intergenic
1121795228 14:96728981-96729003 TGATGTGCACCTGTGTGTGTGGG - Intergenic
1122063543 14:99155902-99155924 TTATGTGCATGTGTGTGTGTGGG + Intergenic
1122209986 14:100167585-100167607 GCATGTGTGTGTGTGTGTGTGGG - Intergenic
1122828623 14:104384356-104384378 GAATGTGCACATGTGTGAAGGGG + Intergenic
1122979773 14:105186275-105186297 GTGTGTGGAGGTGTGTGTGGGGG + Intergenic
1123207235 14:106725324-106725346 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123212256 14:106772318-106772340 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123635977 15:22359365-22359387 GTATGTGTGTGTGTGTGTGGGGG + Intergenic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124200184 15:27672731-27672753 GCATGTGCATGTGTGTGTATGGG - Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124250710 15:28104953-28104975 GTGTGTGTACATGTGTGTGGTGG + Intergenic
1124250806 15:28105502-28105524 GGATGTGGGGGTGTGTGTGGTGG + Intergenic
1124493189 15:30171025-30171047 GCTTGTGCAGCTGTGTGTGAGGG + Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1124678753 15:31711008-31711030 GCATGTGCAGGTGTGTATTTCGG + Intronic
1124750345 15:32367300-32367322 GCTTGTGCAGCTGTGTGTGAGGG - Intergenic
1124827742 15:33115499-33115521 GTGTGTGCGTGTGTGTGTGGGGG - Intronic
1125551734 15:40550090-40550112 TGATGAGCACGTGTGTGTGCCGG + Intronic
1125735876 15:41925488-41925510 GCATGTACTAGTGTGTGTTGTGG + Intronic
1125882213 15:43204631-43204653 GAATGTGTATATGTGTGTGGTGG - Intronic
1126270584 15:46812613-46812635 GCATGTGTGTGTGTGTGAGGGGG - Intergenic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1126528426 15:49684961-49684983 GCATGTGCGTGTGTGTATGTGGG - Intergenic
1126654781 15:50965414-50965436 GCATGTGCACATGCTGGTGGTGG + Intronic
1126685560 15:51246262-51246284 GCATGTACATGTGTGTTTGGGGG - Intronic
1127055879 15:55130759-55130781 GTATGTGTGTGTGTGTGTGGTGG + Intergenic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127867044 15:63041897-63041919 GCATGTGTGCGTGTGTGTGCGGG - Intergenic
1128282548 15:66408526-66408548 GTATGTGTGCGTGTGTGTGGGGG + Intronic
1129186807 15:73912393-73912415 GCATGTGGGTTTGTGTGTGGGGG - Intergenic
1129460647 15:75698569-75698591 ACATGTACACACGTGTGTGGCGG + Intronic
1129706254 15:77796181-77796203 GCATGTCAGAGTGTGTGTGGGGG - Intronic
1129724219 15:77893471-77893493 ACATGTACACACGTGTGTGGCGG - Intergenic
1130185356 15:81675777-81675799 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1130303555 15:82698485-82698507 GCATGTGTGTGTGTGTGTAGGGG - Intronic
1130396041 15:83502400-83502422 GTATGCACACGTGGGTGTGGAGG - Intronic
1130447703 15:84019062-84019084 GTGTGTGTATGTGTGTGTGGTGG - Intronic
1130450804 15:84049951-84049973 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
1130836663 15:87656475-87656497 GCATGGGCATGTGTGTGTGGAGG + Intergenic
1130856786 15:87846557-87846579 ACATCTGCATGTGTGTGTGAAGG + Intergenic
1131107877 15:89747029-89747051 GCATGCGCATGTGTGTGTGGTGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131202659 15:90413219-90413241 GTATGTACACATGAGTGTGGGGG - Intronic
1131569772 15:93522828-93522850 GTCTGTGCATGTGTGGGTGGGGG + Intergenic
1131619459 15:94052156-94052178 GTGAGTGCATGTGTGTGTGGGGG - Intergenic
1131766537 15:95681800-95681822 GCATGTGGTGGTGTGTGGGGTGG - Intergenic
1131855465 15:96588780-96588802 GCACATGCATGTGTGTGGGGGGG + Intergenic
1132100859 15:99021968-99021990 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1132606994 16:797742-797764 CCGAGTGCAGGTGTGTGTGGGGG + Exonic
1132613032 16:827126-827148 ACCTGTGCACGTGTGTGAGGTGG + Intergenic
1132649288 16:1013304-1013326 CCATGTGCACGGGTGTGTCCTGG - Intergenic
1133291761 16:4727086-4727108 GCAGGTGCACGATTGTGTCGTGG + Exonic
1133445287 16:5854561-5854583 GAATGTGTGCTTGTGTGTGGGGG - Intergenic
1133612861 16:7449712-7449734 GTATGTGTGTGTGTGTGTGGGGG + Intronic
1134116218 16:11550781-11550803 GTATGTGGCCGGGTGTGTGGTGG - Intronic
1134234751 16:12456722-12456744 GTATGTGCATGTGTGCCTGGGGG + Intronic
1134309056 16:13059469-13059491 ACATGTGGACATGTGGGTGGGGG + Intronic
1134853263 16:17499219-17499241 GCATGTGCACATGTGTGTATCGG - Intergenic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1135480917 16:22819532-22819554 GCAGGGGAATGTGTGTGTGGAGG + Intronic
1135505253 16:23030904-23030926 GCATGTGTCAGTGAGTGTGGGGG - Intergenic
1135739193 16:24958756-24958778 GCATGTGTCTGTGTGTGTTGTGG - Intronic
1135993616 16:27232212-27232234 GCTTGTGCCCATGTGTGTTGAGG - Intronic
1136690410 16:32024496-32024518 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136790999 16:32968060-32968082 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136876572 16:33863050-33863072 GCATGTGTGTGTGTGTGGGGGGG - Intergenic
1136878814 16:33885872-33885894 GTGTGTGCACGTATGTGTGCTGG + Intergenic
1137037012 16:35576159-35576181 GCAGGGGCACGGGTGTGGGGGGG + Intergenic
1137490840 16:48931315-48931337 GCAAGTGCAGGTGTGTATGAAGG - Intergenic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138552232 16:57754194-57754216 GCCTGTGCCCTGGTGTGTGGGGG + Intronic
1138590647 16:57997971-57997993 GCATGAGCACCAGTGTCTGGCGG - Exonic
1138981902 16:62280045-62280067 GCATGTGTATGTGTGCTTGGGGG - Intergenic
1139037260 16:62962448-62962470 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1139269775 16:65671292-65671314 GCTTGTGCAACTGTGTGTGCAGG + Intergenic
1140186980 16:72782836-72782858 GCACATGCATGTGTGTGTGCAGG - Intergenic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140263825 16:73403424-73403446 GCATCTGCACGGGTGTGTGAAGG + Intergenic
1140378025 16:74460939-74460961 GTATGTGTGCGTGTGTGTGCGGG - Intronic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140710482 16:77672745-77672767 ACATGTGCAGGTTTGTGGGGTGG - Intergenic
1140722629 16:77785029-77785051 GCACGTGGGGGTGTGTGTGGGGG - Intergenic
1140958578 16:79890859-79890881 GCATGTGCTCATGTATGTGTGGG - Intergenic
1141307605 16:82881180-82881202 GCATGTGCTTGGGTGTGTAGAGG + Intronic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141481543 16:84309837-84309859 GTGTGTACATGTGTGTGTGGGGG + Intronic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141928868 16:87187162-87187184 ACATGTGTGCATGTGTGTGGAGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983472 16:87564544-87564566 GCACATGCATGTGTGTGTGTGGG + Intergenic
1142124976 16:88405698-88405720 GGAAGTGCACGTGGGTGTGCAGG + Intergenic
1142289847 16:89188619-89188641 GCATGGGCATCTGTGTGTGCCGG - Intronic
1142312805 16:89323697-89323719 GAACGTGCAGGGGTGTGTGGAGG - Intronic
1142410599 16:89914223-89914245 GCATGTGTGCCTGTGTGTGTGGG + Intronic
1142410629 16:89914484-89914506 GTGTGTGCGCCTGTGTGTGGGGG + Intronic
1203093206 16_KI270728v1_random:1229517-1229539 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142639170 17:1275696-1275718 GTGTGTGAATGTGTGTGTGGGGG + Intergenic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1142753026 17:1999677-1999699 GCCTGTGCGTGTGTGTGTGGGGG - Intronic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1144648396 17:16990859-16990881 GCATGTGTGAATGTGTGTGGGGG - Intergenic
1144792684 17:17869937-17869959 GCATATGCATGTGTGTGTACAGG - Intronic
1146589546 17:34116837-34116859 CCTTTTGCAAGTGTGTGTGGGGG + Intronic
1146613275 17:34327733-34327755 GTGTGTGTGCGTGTGTGTGGGGG + Intergenic
1146669939 17:34730241-34730263 GTGTGTGCATGTGTGTGTGCGGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146913303 17:36661741-36661763 GCAGGTGCATGTGTGTGTCTGGG - Intergenic
1146913322 17:36662017-36662039 GCATGTGCATGTGTGTGTCTGGG - Intergenic
1147055863 17:37834484-37834506 GCATGTGCACATATGTGGGTGGG - Intergenic
1147257915 17:39193033-39193055 GCATGCCCGCGTGTGTGTTGGGG - Intronic
1147306630 17:39568723-39568745 GCAGGGGCATGTGTGTGTGAGGG - Intergenic
1147383437 17:40069024-40069046 GCACGTGTCCGTGTGTGTGCCGG + Intronic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1147875783 17:43619429-43619451 GTGTGTGCATGTGTGTATGGAGG - Intergenic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148339764 17:46866438-46866460 GAATGTGGATGTGTGTGTGAGGG + Intronic
1148485578 17:47988678-47988700 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1148784447 17:50139178-50139200 GCATGTGCAGGTGTGAGGGTAGG + Intronic
1148789807 17:50166852-50166874 GTATGTGGGGGTGTGTGTGGGGG - Intronic
1148789829 17:50166912-50166934 GTGTGTGAAGGTGTGTGTGGGGG - Intronic
1148855616 17:50577751-50577773 GCAGGTGCACGTGTCTGGTGTGG + Intronic
1149130562 17:53296169-53296191 GTTTGTGCACATGGGTGTGGTGG - Intergenic
1149458643 17:56809850-56809872 GAAGGTGCAGGTGTGTGTGAGGG - Intronic
1149712026 17:58752161-58752183 GCAAGTGCATGTGTGTTTGGTGG + Intergenic
1150013595 17:61530350-61530372 TAATCAGCACGTGTGTGTGGTGG - Intergenic
1150134961 17:62690481-62690503 ACATGTGCAAGTGTGTGGGGGGG - Intronic
1150371859 17:64645757-64645779 GCATGTCCACCTGGGTGTGGTGG - Intronic
1151176460 17:72292580-72292602 GCATGTGGATGTGTGGATGGAGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151267979 17:72971303-72971325 GTGTGTGTATGTGTGTGTGGAGG - Intronic
1151339593 17:73461901-73461923 GCATGTACATGTCTGTATGGTGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191881 17:78893081-78893103 GCGTGTGCAGGGGTGTGTGTGGG + Intronic
1152191882 17:78893109-78893131 GCACATGCACATGTGTGTGCAGG + Intronic
1152205579 17:78972874-78972896 GTATGTGCAGGTGTGTGTGTGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152318037 17:79592257-79592279 GCATGTGTATGTGGGTGGGGGGG + Intergenic
1152343931 17:79740250-79740272 GAATGTGGAGATGTGTGTGGTGG + Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152602733 17:81273057-81273079 CCATGTGTGCGTGTGTTTGGGGG - Intronic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152882701 17:82828780-82828802 ACATGTGCATATCTGTGTGGGGG - Intronic
1153367856 18:4278656-4278678 GTATGTGTATGTGTGTGTGTGGG + Intronic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157688450 18:49661746-49661768 CCCTGTGCACGTGTGTGTGCTGG + Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158181648 18:54722718-54722740 ACATGTGCATGTTTGTGTGCAGG - Intronic
1158429205 18:57368963-57368985 GTGTGTGTATGTGTGTGTGGGGG - Intronic
1158939523 18:62394015-62394037 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
1159375601 18:67588551-67588573 GCATGTGCATGTATGTGTGCAGG + Intergenic
1159482728 18:69011271-69011293 CAATGTGCACATGTTTGTGGCGG + Intronic
1159505335 18:69328314-69328336 GCATGCACACGTGCGTGTGGTGG - Intergenic
1159778368 18:72630542-72630564 GCATGTGTGTGTGTGTGGGGGGG - Intronic
1160025186 18:75210452-75210474 GTATGTGTATGTGTGTGTGTTGG + Intergenic
1160137420 18:76284260-76284282 GCATGTGGAAGTGAGTGTGCAGG - Intergenic
1160412981 18:78687619-78687641 CCGGGTGCACCTGTGTGTGGTGG - Intergenic
1160523278 18:79521059-79521081 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523296 18:79521173-79521195 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523308 18:79521245-79521267 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523354 18:79521531-79521553 TGATGTGTATGTGTGTGTGGGGG + Intronic
1160656859 19:277264-277286 GCTTGTCCACGTGTGGGCGGGGG + Intergenic
1160962424 19:1729306-1729328 GTATGTGCATGTGTGTGTGCAGG + Intergenic
1161887718 19:7009947-7009969 ATATGTGTATGTGTGTGTGGTGG + Intergenic
1161890190 19:7030344-7030366 ACGTGTGTATGTGTGTGTGGCGG - Intergenic
1161891259 19:7040390-7040412 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1161893344 19:7058851-7058873 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1162015291 19:7842902-7842924 GTGTGTGCATGTGTGTGTGAAGG + Intronic
1162015300 19:7843061-7843083 GTATGTGCATGTGTGTGTATAGG + Intronic
1162015304 19:7843120-7843142 TCATGTGCATGTGTGTGTATAGG + Intronic
1162015308 19:7843177-7843199 GTATGTGCATGTGTGTGTATAGG + Intronic
1162301531 19:9847698-9847720 GTGTGTGCATGTGTGTGTGCTGG + Intronic
1162301566 19:9847892-9847914 GCATGTGCGCCTGTGAGGGGAGG + Intronic
1162478423 19:10914461-10914483 GCGAGTGTACGTGTGTGAGGAGG + Intronic
1162625309 19:11880246-11880268 ACATGCACACGTATGTGTGGGGG + Intronic
1164160912 19:22624854-22624876 GCATGTGAAAGTGGGGGTGGGGG - Intergenic
1164527701 19:29023946-29023968 ACATGTGCAGGTGTCTGGGGAGG + Intergenic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165182625 19:33985789-33985811 GCATGTGAATGTATGTGAGGAGG + Intergenic
1165453268 19:35897160-35897182 GCATGCAGATGTGTGTGTGGTGG - Intronic
1166158419 19:40933181-40933203 GCATGAGCAAGTGTGTGTCAAGG + Intergenic
1166196185 19:41207340-41207362 GAGTGTGTATGTGTGTGTGGAGG - Exonic
1166232403 19:41432616-41432638 GCATGTGTGTGTGTGTGTGTAGG + Intronic
1166751495 19:45165860-45165882 CCACGTGCCTGTGTGTGTGGAGG + Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167504542 19:49864136-49864158 GCATGGGCACGTGCACGTGGCGG - Intronic
1167676603 19:50890624-50890646 GCATGCACATGTGTATGTGGTGG + Intergenic
1168013607 19:53554281-53554303 GCACGCGCACATGTGTGTCGGGG + Intronic
1168018783 19:53594305-53594327 GGCTGTGCAGGTGTGTGTTGTGG + Intergenic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
1168372157 19:55844889-55844911 GCATGTGTGTGTGTGTTTGGGGG + Intronic
1168452335 19:56476283-56476305 GCATGTGTACATTTGAGTGGAGG - Intronic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925224063 2:2167363-2167385 GAAGGTGAAGGTGTGTGTGGTGG - Intronic
925370498 2:3341533-3341555 GGAGGTGCAGCTGTGTGTGGAGG + Intronic
925411356 2:3641698-3641720 AAATGTGCAAGTGTGAGTGGAGG + Intronic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925517907 2:4705423-4705445 ACACGTGTGCGTGTGTGTGGGGG - Intergenic
925753347 2:7109693-7109715 GCATGTGTGTGTGTGTGTGTTGG + Intergenic
926055021 2:9769413-9769435 GCATACACAGGTGTGTGTGGGGG - Intergenic
926087621 2:10029786-10029808 GCTTGTGTGTGTGTGTGTGGCGG - Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926589985 2:14730265-14730287 ACATGTGCATGTGTGTGTGTTGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927477141 2:23422811-23422833 GCATGTGCAGGTGGGTGGGAAGG + Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927687205 2:25179330-25179352 GCATGTGTGTGTGTGTGTGATGG + Intergenic
927848217 2:26482735-26482757 GCATGTGTGCGTGTGTGAGTGGG + Intronic
928025747 2:27737078-27737100 ACATGGGCACCTCTGTGTGGGGG + Intergenic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
928739340 2:34331691-34331713 GCATGTACGTGTGTGTGTGGTGG + Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929769642 2:44880862-44880884 GCCTGTCCCAGTGTGTGTGGGGG - Intergenic
931025402 2:58108563-58108585 GCATGTGTCAGTGTGTGTTGAGG - Intronic
931244579 2:60481446-60481468 GCATGTGTATGTGCTTGTGGTGG - Intronic
931516574 2:63053728-63053750 GCGTGTGCGTGTGTGTGTGCAGG + Intronic
931920934 2:67014884-67014906 GCATGTGCATGTGTATGTATTGG + Intergenic
932006260 2:67930174-67930196 GTATGTGCATGTGTGGGTGAAGG + Intergenic
932129626 2:69176080-69176102 GTGTGTGTATGTGTGTGTGGGGG - Intronic
932224060 2:70025190-70025212 GCATGTGAATGTGTGTGTGTTGG + Intergenic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932702925 2:74003188-74003210 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
932781519 2:74561459-74561481 GCCTGTGCACATCTGTGTGCTGG - Intronic
932825987 2:74940639-74940661 GCATGCGCACGTGTGTGTATGGG - Intergenic
933643847 2:84793185-84793207 GCATGCGTGTGTGTGTGTGGTGG - Intronic
933766623 2:85713543-85713565 GCTTGTGCATGTGTATGTGTGGG - Intergenic
933877112 2:86630634-86630656 GTATGTGTACATGTGTGTGAGGG - Intronic
934639892 2:96021540-96021562 GCTTGTGTACGTGTGTCTGACGG + Intergenic
934699107 2:96424206-96424228 GTATGTGTATGTGTTTGTGGGGG - Intergenic
935332526 2:101987597-101987619 GTAGGTGCACGTGTGTGTTTAGG - Intergenic
935547588 2:104417325-104417347 GCATGTGAGTGTGTGCGTGGAGG - Intergenic
935962498 2:108440677-108440699 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
936631911 2:114212536-114212558 GCATGTGCATGAGTGTGTGTGGG + Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937233328 2:120415462-120415484 GTGTGTACACGTGTGTTTGGAGG + Intergenic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
937645740 2:124264359-124264381 GTGTGTGCCTGTGTGTGTGGGGG - Intronic
938410030 2:131055875-131055897 GTGCATGCACGTGTGTGTGGTGG + Intronic
938776892 2:134549755-134549777 GCATGTATACGTGTATGTGTGGG - Intronic
939316036 2:140550604-140550626 GCATGTGTGTGTGTGTTTGGAGG - Intronic
939449698 2:142357714-142357736 GCATGTGTATGTGTGTGTGTAGG - Intergenic
939993029 2:148894015-148894037 GTGTGTGTATGTGTGTGTGGTGG - Intronic
940447968 2:153800094-153800116 AGATATGCATGTGTGTGTGGTGG - Intergenic
940743699 2:157542629-157542651 GAATGTCCTCATGTGTGTGGAGG - Intronic
941557598 2:167001278-167001300 GCATGTGCATGTGTTCTTGGGGG - Intronic
941600110 2:167532541-167532563 GTATGTGTAAGTGTGTGTGTAGG - Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
945543725 2:211122951-211122973 GTATGTGCACGTGTGCCTGTGGG + Intergenic
945832146 2:214800319-214800341 GTATGTGCACTTGTGTGTATTGG + Intronic
946144416 2:217718133-217718155 GCATGTGTGTGTGTGTGTGGTGG - Intronic
946381510 2:219352021-219352043 GCATGTGTATGTACGTGTGGGGG - Intergenic
946414966 2:219535325-219535347 GTATGTGTGTGTGTGTGTGGGGG + Intronic
946414972 2:219535362-219535384 CTGTGTGTACGTGTGTGTGGGGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947084381 2:226434773-226434795 GTGTGTGTACATGTGTGTGGAGG - Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
948183680 2:236002417-236002439 GCATGTGCACATGTGTGAGTAGG + Intronic
948721814 2:239905456-239905478 GCATGCGTATGTGTGTGTGGTGG + Intronic
948743250 2:240062897-240062919 GTGCGTGCATGTGTGTGTGGTGG + Intergenic
948758546 2:240174419-240174441 GCATGTGTGTGTGTGTGTGTAGG + Intergenic
948813680 2:240499054-240499076 GCACGTGGAAGTGTGTGGGGCGG + Intronic
948855485 2:240728429-240728451 GTATGTGTACGTGTGTGTCCTGG - Intronic
1169247871 20:4038128-4038150 GCATGTGCGTGTGTGTCTGGGGG + Intergenic
1169582459 20:7039256-7039278 GTATGGGTACGTGTGTGTTGGGG + Intergenic
1169688798 20:8307212-8307234 GCATGGGCACGTGTGGGTGCAGG + Intronic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170604157 20:17863491-17863513 ACATGGGCCTGTGTGTGTGGTGG - Intergenic
1170759713 20:19238945-19238967 GCATGCGCCCATGTGTGTGCTGG - Intronic
1170815792 20:19713218-19713240 GCATGTCCACGTGTGCTTGTGGG - Intronic
1171249053 20:23634977-23634999 GTGTGTGCACATATGTGTGGGGG - Intronic
1171262895 20:23748747-23748769 GCCTGTGCATGGATGTGTGGGGG - Intronic
1171435422 20:25118355-25118377 GGATGTGCACGTGAGTGTGGTGG - Intergenic
1172648396 20:36485977-36485999 GACTGTGCTCCTGTGTGTGGTGG + Intronic
1172995759 20:39069428-39069450 ACATGTGTGCGTGTGTGTGAGGG + Intergenic
1173028669 20:39333925-39333947 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1173742037 20:45407906-45407928 GCGTGTGTACGTGTTTGTGTGGG + Intronic
1173850953 20:46217607-46217629 GCATGGGCAGGTATGTGTGTGGG - Intronic
1174039334 20:47688007-47688029 GTATGTGACTGTGTGTGTGGGGG + Intronic
1174063582 20:47849100-47849122 GGATGTGCTTGTGTGTGTGCTGG - Intergenic
1174889869 20:54380063-54380085 ATGTGCGCACGTGTGTGTGGGGG - Intergenic
1175198147 20:57260327-57260349 GCAGGTGGACATGTGTGTAGAGG - Intronic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175485267 20:59341592-59341614 GTGTGTGCATGTGTGTATGGGGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175850421 20:62087942-62087964 GCGTGTGCAGGTGAGTGTGCAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176020472 20:62960157-62960179 GCAGGCGCATGTGTGTGTGTTGG + Intronic
1176030232 20:63008055-63008077 GGAGCTGCACGTGTGTGGGGCGG + Intergenic
1176064191 20:63186392-63186414 ACCTGTGCATTTGTGTGTGGGGG + Intergenic
1176106063 20:63388071-63388093 GCATGTGCATATGTGTGTGTGGG - Intergenic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176960477 21:15153753-15153775 GCATGTGCAAGGGTGGGTGATGG + Intergenic
1177384953 21:20396885-20396907 GCAGGTGAACGAGTGAGTGGGGG + Intergenic
1177540003 21:22480232-22480254 GTTTGTGTGCGTGTGTGTGGGGG + Intergenic
1177891795 21:26813570-26813592 GGGTGTGTATGTGTGTGTGGAGG + Intergenic
1178573132 21:33759679-33759701 ACATGAGCACGTGTGTGTTTTGG - Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178907553 21:36649241-36649263 GCATGTGTGCGTGTGTGTGGGGG - Intergenic
1179004320 21:37497041-37497063 GTATGTACATGTGTGTGTGGGGG - Intronic
1179022515 21:37653044-37653066 TCATCTGCCCGTGTGTGTGTGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179393251 21:41013182-41013204 GCATGTGCCTGAGTGTGTGTGGG - Intergenic
1179620969 21:42615903-42615925 GTATGTGTATTTGTGTGTGGGGG - Intergenic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179974572 21:44857014-44857036 AAATGTGCACGTGTGTCTGAAGG - Intronic
1179998322 21:44984156-44984178 GTGTGTGGGCGTGTGTGTGGGGG - Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1180950295 22:19717762-19717784 GTGTGTGCATGTGTGTTTGGTGG - Intronic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1181991960 22:26843868-26843890 GCATGTGAGTGTGTGTGTGTGGG + Intergenic
1182012653 22:27013562-27013584 GCATATGCATGTGTGTGAGAGGG + Intergenic
1182090819 22:27593590-27593612 GCATGTGCACATGCATGTGTAGG + Intergenic
1182594205 22:31405665-31405687 GCATGTGTGTGTGTGTGGGGGGG + Intronic
1183062139 22:35342707-35342729 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062151 22:35342778-35342800 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062168 22:35342903-35342925 ACGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062187 22:35343021-35343043 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062206 22:35343144-35343166 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062221 22:35343242-35343264 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062252 22:35343439-35343461 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183062263 22:35343544-35343566 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183465041 22:37975513-37975535 GTATGTACACGTGTGTGGGAGGG + Intronic
1183588233 22:38765528-38765550 GTGTGTGCACCTGTGTCTGGAGG - Intronic
1183978585 22:41527005-41527027 GCAGAGGCAGGTGTGTGTGGAGG - Exonic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184320431 22:43738666-43738688 GTATGTGCAAGTGTGTGTGATGG - Intronic
1184678358 22:46055410-46055432 GTATGTGCACGTGGGTGTGCAGG + Intronic
1184821353 22:46911081-46911103 ACATGTGCACGTGTATGGTGTGG + Intronic
1184821647 22:46914005-46914027 GCATGTGCCTGCGTGTGTGACGG - Intronic
1184924652 22:47628761-47628783 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924666 22:47628913-47628935 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184934209 22:47707161-47707183 GCATGTGCATGTGTGTCCGATGG + Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185203999 22:49526348-49526370 GTGTGTGCACCTGTGTGTGCAGG + Intronic
949240588 3:1866451-1866473 GCACGTGCATGTGTGTGAGAGGG - Intergenic
949608074 3:5676092-5676114 GACTGTTCAGGTGTGTGTGGTGG - Intergenic
949790680 3:7788812-7788834 TAAAATGCACGTGTGTGTGGGGG - Intergenic
949905667 3:8856352-8856374 GTGTGTGTGCGTGTGTGTGGGGG + Intronic
950425856 3:12924417-12924439 GCATCTGCATGTGTGTGTCTAGG + Intronic
950534210 3:13569970-13569992 GGCTGTGCATGTGTGTGTGTGGG + Intronic
950873809 3:16251848-16251870 GCAGGAACACGTGTGTGTGCAGG + Intergenic
951588430 3:24238261-24238283 GTATGTGTGTGTGTGTGTGGGGG + Intronic
951603777 3:24408523-24408545 GCATGAGCATGTGTGTGAGCTGG + Intronic
952665413 3:35898255-35898277 GTATGTGTGTGTGTGTGTGGGGG - Intergenic
952929583 3:38348642-38348664 TGATGTGCATGTGTGTGTGATGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953229471 3:41051873-41051895 ACACGTGCACATGTGTGTGTTGG + Intergenic
953369298 3:42373547-42373569 GGGTGTGCATGTGTGTGTGCAGG + Intergenic
953553200 3:43921133-43921155 GCATATGCACATTTGTGCGGTGG + Intergenic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954122276 3:48506328-48506350 GCATGGGCAGGAGTGAGTGGAGG + Intergenic
954134080 3:48574052-48574074 GTATGTGGATGTGTGTGTGCAGG - Intronic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
954879171 3:53822379-53822401 GGATGAGCACGTGGGTCTGGGGG + Intronic
955530817 3:59871449-59871471 GTATGTGTGCGTGTGTGGGGGGG - Intronic
956016580 3:64890151-64890173 GCATGTGCAGCTGTGGATGGAGG - Intergenic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
956816699 3:72914591-72914613 CCATGTGCGTGTGTGTGAGGGGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957597289 3:82283624-82283646 AAGTGTGCACTTGTGTGTGGTGG - Intergenic
957605819 3:82397920-82397942 GTATGCGCACGTGTGTGTTTTGG - Intergenic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
958581892 3:96037512-96037534 GTTTGTGTGCGTGTGTGTGGTGG + Intergenic
958888194 3:99752695-99752717 GTACATGCATGTGTGTGTGGGGG - Intronic
959022242 3:101200421-101200443 GTTTGTGTTCGTGTGTGTGGTGG - Intergenic
959117683 3:102196878-102196900 GTGTGTGCACATGTGTGTGATGG - Intronic
959158993 3:102700953-102700975 GTGTGTGCACATGTGTGTGATGG - Intergenic
959204686 3:103291080-103291102 GGATGTGTATGTGTGTGTGTTGG - Intergenic
960015914 3:112887685-112887707 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
960050467 3:113234373-113234395 GCATGTGCACACATGTGTGTAGG + Intronic
960223150 3:115140539-115140561 GAGTGTGTATGTGTGTGTGGTGG + Intronic
960334310 3:116397392-116397414 GTGTGTGTATGTGTGTGTGGGGG - Intronic
960534408 3:118800831-118800853 GGGTGTGTATGTGTGTGTGGAGG - Intergenic
961024299 3:123539685-123539707 GCCTGTGCACCTGTTTGAGGTGG + Intronic
961515520 3:127431340-127431362 GTGCGTGCACGTGTGTGTGCAGG + Intergenic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961643633 3:128380844-128380866 ACATGTGCACCTGTGGGTGGAGG + Intronic
961863047 3:129933503-129933525 GCATGTGAGTGTGTGTGAGGAGG + Intergenic
962899303 3:139744936-139744958 GTATGTGCAAGTTTGTGTGAAGG - Intergenic
962924212 3:139976840-139976862 GCATGTGCACACATGTGTGTTGG + Intronic
963084526 3:141424648-141424670 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
963284749 3:143423202-143423224 GTGTGTGTACGTGTGTGTGAGGG - Intronic
964054971 3:152443185-152443207 GCATGTGTGTGTGTGTGGGGGGG - Intronic
964873735 3:161342259-161342281 GAATATGCACATGTGGGTGGTGG + Intergenic
966357763 3:179100001-179100023 GTATGTGTGCGTGTGTGTGTAGG - Intergenic
966471595 3:180295282-180295304 GTATGTGCGTGTGTGTGTAGGGG - Intergenic
966672582 3:182544542-182544564 ACATGTGTACTTGTCTGTGGAGG + Intergenic
967463416 3:189774490-189774512 GTATGTGCACCTGTGTTTGAAGG + Intronic
967489700 3:190076166-190076188 GTGTGTGCATGTGTGTTTGGTGG - Intronic
967503027 3:190222309-190222331 GCATGTGCGTGTGTGTCGGGGGG + Intergenic
967687484 3:192434493-192434515 GATTGTGCATGTGTGTGTGCAGG + Intronic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967773460 3:193359801-193359823 GCATGTGTGTGTGTGTGTGGTGG + Intronic
968446864 4:656609-656631 TCATGGGCATGTGTGTGGGGCGG - Intronic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968522948 4:1042484-1042506 GTATGTGGAGGTGTGTGTGTCGG - Intergenic
968544739 4:1193019-1193041 GCATGTCCACATATGTGTGTGGG - Intronic
968580950 4:1394796-1394818 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581091 4:1395598-1395620 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581102 4:1395662-1395684 ACATGGGCACGTGTGTGAGCAGG - Exonic
968605921 4:1535424-1535446 ATGTGTGCACGTGTGTGTGCTGG + Intergenic
968932570 4:3589076-3589098 GTCTGTGCATGTGTGTGTGATGG - Exonic
968932571 4:3589125-3589147 GTCTGTGCATGTGTGTGTGATGG - Exonic
968933852 4:3599635-3599657 GCAGGTGTGCATGTGTGTGGGGG + Intergenic
969184213 4:5463517-5463539 ACGTGTGCATATGTGTGTGGGGG - Intronic
969239914 4:5891161-5891183 GTGTGTGTATGTGTGTGTGGTGG - Intronic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969323268 4:6425918-6425940 GCATGTGCATGTGTGTTGCGGGG + Intronic
969470750 4:7386332-7386354 GCATGTGTTCATGTGTATGGTGG - Intronic
969470755 4:7386507-7386529 GCATGTGTGCATGTGTATGGTGG - Intronic
969470759 4:7386614-7386636 GCATGTGTTCATGTGTATGGTGG - Intronic
969470764 4:7386795-7386817 GCATGTGTGCATGTGTATGGTGG - Intronic
969470769 4:7386990-7387012 GCATGTGTGCATGTGTATGGTGG - Intronic
969470774 4:7387175-7387197 GCATGTGTGCATGTGTATGGTGG - Intronic
969470779 4:7387370-7387392 GCATGTGTGCATGTGTATGGTGG - Intronic
969470785 4:7387647-7387669 GCATGTGTGCATGTGTATGGTGG - Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970005067 4:11402577-11402599 GCATGTGTGTGTGTGTGTGCAGG + Intronic
970008987 4:11437940-11437962 GGATGTGTACGTCTTTGTGGGGG - Intergenic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
970199134 4:13584402-13584424 GCATGTGTGCGTGTGTGGCGGGG + Intronic
970416288 4:15860967-15860989 GGCTGTGCACGTGTGGGTGCAGG + Intergenic
970514565 4:16815324-16815346 GTATGGGGAGGTGTGTGTGGAGG + Intronic
971342523 4:25783637-25783659 GTATGTGCATGTGTGGGTGGGGG + Intronic
971632879 4:29017586-29017608 GCATGTGTATGTGTGTGTGTGGG - Intergenic
972167700 4:36307560-36307582 GAATGTGTATGTGTGTGGGGAGG + Intronic
972171078 4:36346228-36346250 GTGTGTGCATGTGTCTGTGGGGG - Intergenic
972241841 4:37201794-37201816 GTATGTGTATTTGTGTGTGGTGG - Intergenic
973115775 4:46456625-46456647 GTGTGTGTATGTGTGTGTGGTGG - Intronic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974069944 4:57114271-57114293 ATATGTGCCTGTGTGTGTGGGGG + Intergenic
974482594 4:62465538-62465560 GGATGTGGACATGTGGGTGGTGG + Intergenic
974540868 4:63233003-63233025 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
975170499 4:71227237-71227259 GCATGTACACGAAGGTGTGGTGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975848746 4:78550733-78550755 CCATGTGCAGGTGTTTGTGGAGG + Intergenic
976349945 4:84049829-84049851 GCGTGTGTATGTGTGTGTGTGGG + Intergenic
976484067 4:85580116-85580138 GTATGTGTTTGTGTGTGTGGTGG + Intronic
976955539 4:90893775-90893797 GCGTGTGTGTGTGTGTGTGGGGG + Intronic
977973330 4:103235555-103235577 GCATGTGCATGTATGCGTGTGGG + Intergenic
978277429 4:106968448-106968470 TCATGTGAACGTGTGTGTGTAGG + Intronic
978471545 4:109073129-109073151 GCATGTGTATGTGTGTGTGGGGG + Intronic
978471552 4:109073158-109073180 GCATGTGCATGGGTGTTTGGTGG + Intronic
978620165 4:110629490-110629512 GCGTGTGAAGGTGTGTGTCGCGG + Intronic
978856390 4:113399313-113399335 GTATGTGTACGTGTATGTGTGGG - Intergenic
979100913 4:116613012-116613034 GGACATGCAAGTGTGTGTGGGGG - Intergenic
979616649 4:122750272-122750294 GCATGTGCATGTGTGGATGCAGG + Intergenic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980073596 4:128269114-128269136 GCATGTGTCTGTCTGTGTGGAGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
980644887 4:135630978-135631000 GTATGTGTGTGTGTGTGTGGTGG - Intergenic
980964222 4:139504993-139505015 GCATGTGAATGTGTCTGTGCAGG + Intronic
983271673 4:165569422-165569444 GCATACGCAGGTGTGTGTGTAGG + Intergenic
983319749 4:166180870-166180892 GGAGGTTCATGTGTGTGTGGAGG - Intergenic
984261666 4:177450396-177450418 CCATGTGCACCTGGGTGTGGTGG + Intergenic
984867294 4:184292605-184292627 GTATGTGCGAGTGTGTGTGGAGG + Intergenic
984867305 4:184292714-184292736 GAGTGTGTATGTGTGTGTGGAGG + Intergenic
985515988 5:344805-344827 GTGTGTGCGGGTGTGTGTGGGGG + Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985606504 5:861030-861052 GGGTGTGCAGGTGTGTATGGGGG - Intronic
985702413 5:1381593-1381615 GGATGTGCATGGGTGTGTGCCGG - Intergenic
985730525 5:1544880-1544902 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730556 5:1545135-1545157 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730564 5:1545213-1545235 GTGTGTGCAGGTGTGTTTGGAGG - Intergenic
985843276 5:2325711-2325733 GCAGCTGCACATCTGTGTGGGGG - Intergenic
985859542 5:2460025-2460047 GCCTGTGCATGCCTGTGTGGAGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986273830 5:6256512-6256534 GCATGAGCAGGTGAGTTTGGGGG + Intergenic
986839141 5:11675762-11675784 ATATGTGTATGTGTGTGTGGAGG + Intronic
987390144 5:17367920-17367942 ACGTGTGAGCGTGTGTGTGGGGG + Intergenic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
987903557 5:24046974-24046996 GCATGTGCGTATGTGTTTGGTGG - Intronic
988026651 5:25701916-25701938 GCATGTGCAAATTTGGGTGGGGG + Intergenic
988785609 5:34563482-34563504 GTATGTGGGCGTGTGGGTGGGGG - Intergenic
989724435 5:44571554-44571576 GCTTGTGCCTGTGTGTGTGTGGG - Intergenic
990263646 5:54052734-54052756 GCATGTGTGTGTGTGTGTGCTGG - Intronic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
991295682 5:65077800-65077822 GCATGTGTGCGTGTGTGTGTGGG - Intergenic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
992051478 5:72945165-72945187 GCAGGTGCATGTGTTTGTGTTGG - Intergenic
992175867 5:74148252-74148274 GTATGTGTGTGTGTGTGTGGAGG - Intergenic
992522267 5:77566636-77566658 ACATATGCACGCTTGTGTGGTGG + Intronic
992529378 5:77640367-77640389 GCGCGCGCACGTGTGTGTGCAGG - Intergenic
993502037 5:88675706-88675728 GCAAAAGAACGTGTGTGTGGTGG + Intergenic
993987624 5:94616527-94616549 GCATGTGTGTGTGTGTGTGTAGG - Intronic
994457172 5:100025673-100025695 TCATAGGCATGTGTGTGTGGTGG + Intergenic
994690347 5:103011341-103011363 GTGTGTGTATGTGTGTGTGGCGG - Intronic
995602940 5:113818237-113818259 GCATGTGCATGTGTGTATGCAGG + Intergenic
995700025 5:114925055-114925077 GCGTGCGTACGCGTGTGTGGTGG + Intergenic
995747020 5:115414860-115414882 GCATGTGTGTGTGTGTGGGGGGG + Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996948801 5:129100436-129100458 TCATGTGCAAATGTGTGTGTAGG + Intronic
997333768 5:133088267-133088289 GCATGAGTATGTGTGTGTTGCGG + Intronic
997952410 5:138252917-138252939 GCAAGTCCACCTGGGTGTGGTGG + Exonic
998104445 5:139459477-139459499 GTATGTACACGTGTGTCTGCGGG + Intronic
998176900 5:139907003-139907025 GCATGTGCACATGTGTGTATGGG + Intronic
998394207 5:141807788-141807810 GCGTGTGTGTGTGTGTGTGGGGG - Intergenic
999060938 5:148634351-148634373 GCATGTGAATGTTTGTGTGTGGG - Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
999601785 5:153274487-153274509 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1000274086 5:159717212-159717234 TCAAGTGCACCTGTGTATGGGGG + Intergenic
1000292057 5:159879639-159879661 GCATATGCATGCGTGTGTGTGGG + Intergenic
1000393819 5:160751811-160751833 GGATGTGTGCGTGTTTGTGGTGG + Intronic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1000970907 5:167713571-167713593 GCATATGCACATGAATGTGGTGG - Intronic
1001774194 5:174316367-174316389 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1002021911 5:176368859-176368881 GGATGTGCTGGTGTTTGTGGTGG + Exonic
1002090245 5:176800822-176800844 GCATGTATATGTGTGTGTGTTGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002213051 5:177609667-177609689 GAATGTGCACCAGGGTGTGGCGG - Exonic
1002394893 5:178945026-178945048 GCATGTGTGTGTGTGTGTTGAGG + Intronic
1002450838 5:179317706-179317728 AAATGTACACGTGTGTGTGTGGG - Intronic
1002543970 5:179926059-179926081 AAATGTGCACTTGTGTGGGGTGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002900074 6:1403878-1403900 GCATGTGCGTGTGTGTGTCTCGG - Intergenic
1003453579 6:6260576-6260598 GTATGTGCTTGTGTGTGTGTTGG + Intronic
1003749031 6:9035549-9035571 GTATGTGTATGTGTGTGGGGGGG - Intergenic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1003985056 6:11427166-11427188 GCATGTGTATGTGTGTTTAGGGG - Intergenic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004496241 6:16165898-16165920 GCATGGGAAGGTGTGTGTGTTGG - Intergenic
1004739711 6:18447043-18447065 GTATGTGCATGTGTGTATGTGGG + Intronic
1006105571 6:31714281-31714303 GCATGTGGGTGTGTGGGTGGGGG - Intronic
1006237017 6:32642546-32642568 TCATGTGCATGTGTGTGGGATGG - Intronic
1006247002 6:32746176-32746198 TCATGTGCATGTGTGTGGGATGG - Intronic
1006295414 6:33167924-33167946 GCATGTGTATGTGTGTGTCTAGG - Intronic
1006374244 6:33663045-33663067 GCATGTACACGTGGGTGTGCGGG + Intronic
1006396612 6:33791415-33791437 GCATGTGGATGGTTGTGTGGAGG - Intergenic
1006447443 6:34087705-34087727 GCCTGTGTGTGTGTGTGTGGGGG - Intronic
1006464639 6:34185336-34185358 GCATGTGTATGTGTGTGGGCGGG - Intergenic
1006575058 6:35039074-35039096 GTATGTGTGTGTGTGTGTGGGGG + Intronic
1006668887 6:35717413-35717435 CCATGTGCACGTGTGTTTGTGGG + Intronic
1007263578 6:40581026-40581048 GTATGTGCACATGTATGTGGTGG + Intronic
1007375577 6:41453905-41453927 GCATCTGTGCGTATGTGTGGTGG + Intergenic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007401271 6:41603977-41603999 GCATGTGCATGTGTGTGTGAAGG - Intergenic
1007600576 6:43078257-43078279 GTGTGCGCGCGTGTGTGTGGGGG + Intronic
1007834570 6:44664670-44664692 GCATGTGTGTGTGTGTGGGGCGG - Intergenic
1008406156 6:51120922-51120944 GCATGTGGGTGTGTGTGTGTTGG + Intergenic
1008408846 6:51149486-51149508 GCACGTGCATGTGTGTGAAGAGG + Intergenic
1011105942 6:83781664-83781686 GCATGTGCAGGCATTTGTGGTGG - Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011660475 6:89590021-89590043 GCATCTCCACGTGTGGCTGGAGG - Intronic
1012021660 6:93928948-93928970 GCAAGTGCACATGTGTGTAGAGG + Intergenic
1012175508 6:96077227-96077249 GGATGTGTATGTGTGTGTGTTGG - Intronic
1012422895 6:99084274-99084296 GCATGTCCATGTATGTGTAGAGG + Intergenic
1012729175 6:102858673-102858695 GCACGTGCATGTCTGTGTGTGGG - Intergenic
1012950159 6:105509730-105509752 GCATGTGTGTGTGTGTGGGGTGG + Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013684699 6:112565848-112565870 GCACGTGCACGTGTGTGTCATGG + Intergenic
1013786443 6:113786817-113786839 GTGTGTGCATGTGTGTGTGATGG + Intergenic
1013793955 6:113863948-113863970 GCATGTCCAGGGATGTGTGGTGG - Intergenic
1015142787 6:129954865-129954887 GCATCTGAGCGTGAGTGTGGTGG + Intergenic
1015444292 6:133285492-133285514 GCATGGGCATGTGAGGGTGGAGG + Intronic
1016137722 6:140566684-140566706 ACATGTAAATGTGTGTGTGGGGG + Intergenic
1016504741 6:144766134-144766156 GCACGTGCTTGTGTGTGTGTGGG - Intronic
1016827476 6:148401768-148401790 ACATCTGGATGTGTGTGTGGGGG + Intronic
1017798504 6:157869848-157869870 GTGTGTGCGAGTGTGTGTGGGGG - Intronic
1018375054 6:163202385-163202407 GCATGTGTGTGTGTATGTGGGGG + Intronic
1018723337 6:166590617-166590639 GCACGTGCGTGTGTGTGTTGTGG - Intronic
1019035109 6:169048000-169048022 GCATGTGTGTGTGTGTGTGATGG - Intergenic
1019048697 6:169167302-169167324 ACCTGTGCACGCGAGTGTGGGGG + Intergenic
1019129600 6:169864180-169864202 GCCTGTGCATGTGTTTGTGCAGG - Intergenic
1019285917 7:222936-222958 ACGTGTGCATGTGTGTGTGAGGG + Intronic
1019417751 7:935134-935156 GCAGCTCCAGGTGTGTGTGGTGG - Intronic
1019492127 7:1319687-1319709 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019492143 7:1320024-1320046 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019492159 7:1320361-1320383 GCATGTGTGCGTGTCTGTGTGGG + Intergenic
1019872384 7:3776976-3776998 ACGTGAGCAAGTGTGTGTGGGGG - Intronic
1020082667 7:5295244-5295266 GCGTGTGCGCGTGTGTTAGGAGG + Intronic
1020953910 7:14715519-14715541 GCATGTGTGCCTGTGTGTGTTGG - Intronic
1021372916 7:19872428-19872450 GAATGTGTATGTGTGTGTGATGG - Intergenic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021485890 7:21168180-21168202 CCATGTGCACATGTGTGTGGGGG + Intergenic
1022203662 7:28142295-28142317 GCATGTGCATATGTGTCTGTTGG - Intronic
1022260536 7:28700213-28700235 GCTTGTGCGCGTGTGTGAGTTGG - Intronic
1022410606 7:30135965-30135987 GCATGTGTGTGTGTGTGTTGGGG - Intronic
1022887654 7:34663075-34663097 GTGTGTGTATGTGTGTGTGGCGG + Intronic
1023035674 7:36129377-36129399 GCATGTGCAGGGGAGGGTGGGGG + Intergenic
1023331728 7:39124905-39124927 GTATGTGCGTTTGTGTGTGGAGG + Intronic
1023819196 7:43970925-43970947 ACAGGAGCAGGTGTGTGTGGGGG + Intergenic
1024293700 7:47826251-47826273 GCCTTTGGAGGTGTGTGTGGTGG + Intronic
1024362095 7:48478909-48478931 GCATGTGTTTGTGTGTGTTGAGG + Intronic
1024473668 7:49788852-49788874 GTGTGTGAGCGTGTGTGTGGGGG + Intronic
1024791295 7:52967644-52967666 ACAGATGCATGTGTGTGTGGCGG - Intergenic
1025652540 7:63484072-63484094 GTGTGTGTAGGTGTGTGTGGGGG + Intergenic
1025769533 7:64491242-64491264 GAATTTGCACCTGGGTGTGGTGG + Intergenic
1026442278 7:70455045-70455067 GTATGTGGAAGTCTGTGTGGTGG - Intronic
1026447268 7:70496021-70496043 ACGTGTGCATGTGTGTGGGGGGG - Intronic
1026890335 7:73977985-73978007 GTGTGTGCAAGTGTGTGTGCAGG + Intergenic
1027409838 7:77904794-77904816 GCATATGCATTTGTGTGGGGAGG + Intronic
1029696459 7:102216684-102216706 GCGTGTGGGAGTGTGTGTGGGGG - Intronic
1029696478 7:102216822-102216844 GAATGTGTGTGTGTGTGTGGTGG - Intronic
1029711084 7:102300389-102300411 ACATGCACACGTGTGTGTTGTGG - Intronic
1029744246 7:102507888-102507910 ACAGGAGCAGGTGTGTGTGGGGG + Intronic
1029762237 7:102607050-102607072 ACAGGAGCAGGTGTGTGTGGGGG + Intronic
1030110157 7:106020033-106020055 GCATGTGTGTGTGTGTGGGGGGG + Intronic
1030128236 7:106175325-106175347 ATATGTGTACGTGTGTGTGCAGG - Intergenic
1030147385 7:106370587-106370609 ACATGTGCGTGTGTGTGTGCTGG - Intergenic
1030742585 7:113127884-113127906 GCGTGTGTTTGTGTGTGTGGGGG - Intergenic
1030987469 7:116259386-116259408 ACATGTGCATGTGTGTGTGGTGG - Intergenic
1031001258 7:116417818-116417840 GCATGCACGCGTGTGTTTGGGGG - Intronic
1031785082 7:126019823-126019845 GAACGTGAATGTGTGTGTGGTGG - Intergenic
1032142753 7:129348399-129348421 GCATGTATGTGTGTGTGTGGGGG - Intronic
1032395164 7:131584160-131584182 CCAAGAGCACGTTTGTGTGGGGG + Intergenic
1032453509 7:132054403-132054425 GTGTGTGTAAGTGTGTGTGGAGG - Intergenic
1032688486 7:134259174-134259196 GCATGTTCACATGTGTGTTTGGG - Intronic
1032743125 7:134759572-134759594 GAATGTGCGCATGTGTGTGCAGG + Intronic
1033270631 7:139930017-139930039 GCATGGGGGCCTGTGTGTGGAGG - Intronic
1033601295 7:142890491-142890513 GCGTCTGCAGGTGTGTGTGCAGG - Intergenic
1033601318 7:142890921-142890943 TGGTGTGCATGTGTGTGTGGTGG - Intergenic
1033601333 7:142891050-142891072 TGCTGTGCATGTGTGTGTGGTGG - Intergenic
1034266138 7:149781906-149781928 GTATGTTCACGAGTGTGTGTAGG - Intergenic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034356218 7:150452303-150452325 GCATGTGCGTGTGTGTATGTGGG + Intronic
1034414161 7:150956113-150956135 GCATGTGCGCCTGTATGTGTCGG - Intronic
1034480144 7:151313604-151313626 GCATGTGTATGGGTGTTTGGTGG + Intergenic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035169900 7:157011298-157011320 GCATTTTCAGGTGTGTGTGCGGG + Intergenic
1035226141 7:157433499-157433521 GTGTGTGCATGTGTGGGTGGGGG - Intergenic
1035226669 7:157437729-157437751 GCATATGCATGTCTGTGTGTGGG - Intergenic
1035243165 7:157545316-157545338 GGGTGTGTAGGTGTGTGTGGGGG + Intronic
1035360774 7:158312872-158312894 ACATGAGCATGTGTGTGTGCAGG + Intronic
1035704261 8:1663075-1663097 GCGTTTGTACATGTGTGTGGGGG + Intronic
1035877402 8:3206381-3206403 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035877409 8:3206443-3206465 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1036125393 8:6057460-6057482 GCAGGTGTCTGTGTGTGTGGTGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212126 8:6850833-6850855 GCATGTGCAGGTGTGTGTATGGG - Intergenic
1036766526 8:11552879-11552901 GCATGTGTATGTGCGTGTGGTGG - Intronic
1037382059 8:18296322-18296344 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1037992814 8:23332691-23332713 GCATGTGTATGAGTGTGTGGGGG - Intronic
1038012749 8:23487740-23487762 ACATGGGCAGGTGTGGGTGGGGG - Intergenic
1038063705 8:23939596-23939618 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1038271183 8:26077456-26077478 GCATGTTCATGTATGTGTGTAGG - Intergenic
1038501577 8:28049031-28049053 GAATGTGCATGTGCGTGTGTGGG + Intronic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1039359670 8:36862558-36862580 GAAGGTGCATGTGTGTGGGGTGG - Intronic
1039918005 8:41873954-41873976 GCATGTGCGTTTGTGTGTGTAGG - Intronic
1040009389 8:42648690-42648712 TTTTGTGCAGGTGTGTGTGGTGG - Intergenic
1040628544 8:49180819-49180841 GGATGTGCATGTGTGTGTGTTGG - Intergenic
1040780741 8:51106565-51106587 GCAAATGCATGTGTGTGTGTAGG - Intergenic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041048045 8:53906059-53906081 GGATGTTCACTTGTGGGTGGAGG - Intronic
1041404439 8:57482706-57482728 AAATGTGCATGTGTATGTGGGGG - Intergenic
1041419731 8:57653177-57653199 GCATGTGTGTGTGTGTGTGAAGG - Intergenic
1041551833 8:59111577-59111599 GCATGTGTATGGGTGTGTGGGGG - Intronic
1041808650 8:61883754-61883776 ACATGTGTACGTATGTTTGGAGG - Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1041968161 8:63704942-63704964 GCATGTATATGTGTGTATGGGGG + Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043389261 8:79776367-79776389 GTGTATGCACATGTGTGTGGGGG - Intergenic
1043543621 8:81291020-81291042 GTATGTGTACCTGTGTGTGTAGG + Intergenic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1044309029 8:90671325-90671347 GCATGTGTGAGTGTGTGTGTTGG + Intronic
1044550040 8:93501779-93501801 GCATGTGTGTGTATGTGTGGTGG - Intergenic
1045722275 8:105127564-105127586 GCATGTGTTTCTGTGTGTGGAGG - Intronic
1045768898 8:105710695-105710717 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046363634 8:113195840-113195862 ATATATGCATGTGTGTGTGGGGG - Intronic
1046619197 8:116509934-116509956 GTGTATGCACGTGTGTGTGAGGG - Intergenic
1046655443 8:116889003-116889025 TCATGTGTGTGTGTGTGTGGGGG + Intergenic
1046993868 8:120493460-120493482 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1047523588 8:125614502-125614524 GAGTGTGCAAGTGTGTGTGAGGG + Intergenic
1048167070 8:132071895-132071917 GTATATGCATGTGTGTGTGCAGG + Intronic
1048430105 8:134362260-134362282 GCATCAACGCGTGTGTGTGGCGG - Intergenic
1048609866 8:136010404-136010426 GCTTATGCAGTTGTGTGTGGTGG + Intergenic
1048856589 8:138691377-138691399 GCATGTGTGCATGTTTGTGGAGG + Intronic
1048856622 8:138691910-138691932 GCATGTGTGCATGTTTGTGGAGG + Intronic
1048856633 8:138692090-138692112 GCATGTGTACACGTTTGTGGAGG + Intronic
1048856639 8:138692190-138692212 GCATGTGTGCATGTTTGTGGAGG + Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048865394 8:138757310-138757332 GTGTGTGTATGTGTGTGTGGAGG + Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049254036 8:141604589-141604611 CCCTGTGCATGGGTGTGTGGGGG + Intergenic
1049323181 8:142008164-142008186 ACATGTCCAGGTGTGTGTGACGG - Intergenic
1049351133 8:142165424-142165446 GCATGGGCACCTGTGTCTGAGGG - Intergenic
1049356312 8:142190306-142190328 GCATGTGCACATATGTGTGGGGG - Intergenic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049392828 8:142380942-142380964 GCAGGTGCATGTGTGTGTGGGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049724465 8:144139134-144139156 GCATGCTCATGTGTGTGTGTTGG - Intronic
1049755847 8:144311019-144311041 GGATGAGAACTTGTGTGTGGAGG - Intronic
1049826305 8:144670993-144671015 GTGTGAGCACATGTGTGTGGTGG - Intergenic
1049908672 9:244273-244295 GCGTGTGTGTGTGTGTGTGGTGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050253827 9:3773491-3773513 GTATGTGCATGTGTATGTAGAGG + Intergenic
1050652834 9:7791547-7791569 GGTTGTGCAGCTGTGTGTGGGGG - Intergenic
1051171460 9:14322329-14322351 GCATGTATGTGTGTGTGTGGTGG + Intronic
1051680894 9:19606930-19606952 GCATGTACACATGAGTGTTGTGG + Intronic
1051766199 9:20526656-20526678 GAATGTGCATATGTGTGTGTGGG - Intronic
1051815184 9:21096326-21096348 ACATGTCCACGTGTTTGTGAAGG - Intergenic
1051816899 9:21119486-21119508 ACATGTTCACCTGTTTGTGGAGG + Intergenic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052526559 9:29626650-29626672 TCATGTCCATGTGTATGTGGTGG - Intergenic
1052600087 9:30616025-30616047 GCATACGCGCGTGTGTGTGACGG - Intergenic
1052614812 9:30824234-30824256 GGATCTGCATATGTGTGTGGAGG + Intergenic
1052785026 9:32820445-32820467 GCATGTGCAGGTGTGGGAGAGGG - Intergenic
1052996696 9:34555049-34555071 GCATGTTCCCGTGTGTGTGGTGG + Intronic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053593127 9:39533681-39533703 CCGTGTGTACGTGTGTGTGTCGG - Intergenic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1053875097 9:42536357-42536379 GTGTGTGTATGTGTGTGTGGAGG - Intergenic
1053886812 9:42649955-42649977 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1053918337 9:42962594-42962616 GTATGTGTGTGTGTGTGTGGGGG - Intergenic
1054225831 9:62457405-62457427 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1054236600 9:62565362-62565384 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1054456338 9:65432799-65432821 GCAGGTGTGCATGTGTGTGGGGG - Intergenic
1054457554 9:65442775-65442797 GTCTGTGCATGTGTGTGTGATGG + Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1055306088 9:74930434-74930456 GTATGTGTGCGTATGTGTGGTGG + Intergenic
1055424569 9:76180979-76181001 GTATGTGCATGTGTGAGTGGTGG - Intronic
1055518707 9:77059426-77059448 GCATGTGCACGTTTTTATGTGGG + Intergenic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1056460327 9:86803452-86803474 GCACGTGTATGTATGTGTGGAGG + Intergenic
1056575169 9:87850808-87850830 GCATGTACATGTGTGTGTATTGG - Intergenic
1056741146 9:89256465-89256487 ACATGTGTATGTGTGTATGGAGG + Intergenic
1057275155 9:93672398-93672420 GCAGGTGCAGGTGTGGGTGTGGG + Intronic
1057275163 9:93672434-93672456 GCAGGTGCAGGTGTGGGTGTGGG + Intronic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1058902694 9:109456144-109456166 GCAGGTGTGCGTGTGTGTGTTGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059649770 9:116305082-116305104 GCCTGTGCCTCTGTGTGTGGTGG - Intronic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1061083525 9:128386155-128386177 GGGTGTGCCTGTGTGTGTGGAGG - Intronic
1061225548 9:129279010-129279032 GCTTGTGCAAGGCTGTGTGGGGG - Intergenic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1061698046 9:132392642-132392664 GCCAGTGCACGTGTGAGTGCAGG - Intronic
1061816936 9:133203053-133203075 GCATGTGGCAGTGTGTGTGTAGG + Intergenic
1061816940 9:133203095-133203117 GCATGTATAGGTGTGTGTAGGGG + Intergenic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062032663 9:134368996-134369018 GCTTGTGTGTGTGTGTGTGGGGG + Intronic
1062106860 9:134759952-134759974 GCATGTGTGCATGAGTGTGGGGG - Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198205 9:135286425-135286447 GCACATGCCTGTGTGTGTGGGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062270945 9:135708183-135708205 GCATGTGCCTGTATGTGTGTGGG - Intronic
1062285050 9:135769141-135769163 GCATGTGCACACGTGGGTGACGG + Intronic
1062316155 9:135967952-135967974 GCATGTTCATGTGTGCGGGGGGG + Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1062696514 9:137878642-137878664 GCATGTTCACGTGCCTGTGTAGG + Intronic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185480199 X:440456-440478 GTATGTGCACCTGTGTGGGGGGG - Intergenic
1185487251 X:491472-491494 ACATGTGCGCATGTGTGTGGGGG - Intergenic
1185518452 X:718520-718542 GGCTGTGCATGTGTGTGAGGTGG + Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1185589754 X:1267451-1267473 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589770 X:1267704-1267726 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589800 X:1268225-1268247 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1186015724 X:5191068-5191090 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1186037562 X:5441281-5441303 GGCTGTGCATGTGTGTGGGGAGG + Intergenic
1186404779 X:9292384-9292406 GCATGTGCATGTGTGTATATGGG - Intergenic
1186458381 X:9728848-9728870 GCAGGTGCATGTGTATGTGTTGG - Intronic
1186600359 X:11030236-11030258 GCATGTACATGTGTGTGTAGTGG - Intergenic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1188519921 X:31027109-31027131 GCTTGTACAGGTGTGTGTGTGGG + Intergenic
1189241711 X:39529677-39529699 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1189267307 X:39726728-39726750 GCATGTGTATGTGTGTGTCTGGG + Intergenic
1189306436 X:39990305-39990327 TCATGTTCAAGGGTGTGTGGAGG - Intergenic
1189549230 X:42076029-42076051 GTGTGTGTATGTGTGTGTGGGGG + Intergenic
1189653159 X:43211555-43211577 GCATGTGCATGCTTGTGGGGTGG - Intergenic
1190562433 X:51698646-51698668 GTATGTGCACCTGTGTTTGTGGG + Intergenic
1190596709 X:52059428-52059450 GTATGTGCACGTGGGTGCGAGGG + Intergenic
1190612115 X:52194645-52194667 GTATGTGCACGTGGGTGCGAGGG - Intergenic
1190933294 X:54969327-54969349 GCCTGTGCATGCGAGTGTGGGGG - Intronic
1192260644 X:69504375-69504397 CCCTGTGCAAGTGTGTTTGGCGG - Intergenic
1192438369 X:71156485-71156507 ATATGTGGATGTGTGTGTGGGGG - Intronic
1192481646 X:71491385-71491407 ACAGGTTCAGGTGTGTGTGGAGG + Intronic
1192613777 X:72595672-72595694 GCATCTTTACATGTGTGTGGTGG - Intronic
1192655227 X:72986413-72986435 GCATGTGCACGTGTCTTTATAGG - Intergenic
1192798472 X:74443991-74444013 GTGTGTGCATGTGTGTCTGGGGG + Intronic
1193926064 X:87487112-87487134 ATATGTGCGTGTGTGTGTGGGGG + Intergenic
1194426381 X:93743629-93743651 GCATGTGCATGTGTGTATATTGG + Intergenic
1194866859 X:99079407-99079429 ACATGTGCATGTGTGTGTCGGGG - Intergenic
1195582096 X:106516999-106517021 GCATGTGTGTGTGTGAGTGGAGG + Intergenic
1195727924 X:107936423-107936445 GCACGTGGAGGTGTGTGTGAGGG + Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196047953 X:111275771-111275793 GTATGTGCTCACGTGTGTGGTGG - Intergenic
1196361066 X:114859346-114859368 GCATGTGCACATATGTGTAAAGG + Intronic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1197582962 X:128308422-128308444 GGATTTGCTTGTGTGTGTGGTGG - Intergenic
1197775948 X:130118831-130118853 GCATATGCCTGTGTGTGTGTGGG + Intergenic
1197927336 X:131660634-131660656 TAATGTGCATGTGTGTGTGTAGG - Intergenic
1199450986 X:147978923-147978945 GCTTGTGTGTGTGTGTGTGGGGG + Intergenic
1199615208 X:149650404-149650426 GCATGTGCACATGAGTGAAGGGG - Intergenic
1199683070 X:150240762-150240784 CCATGTACACGTGTGTGAGCGGG + Intergenic
1199694970 X:150337424-150337446 GAATCTGCCCGTGTGTGGGGTGG - Intergenic
1199726228 X:150585097-150585119 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1199807408 X:151314072-151314094 GTATGTGTACGTGGGTGTGGTGG - Intergenic
1200022403 X:153223076-153223098 GTATGTGCATGTGAGTGTGGAGG - Intergenic
1200099858 X:153685052-153685074 GCATGTGCAGGAGGGGGTGGGGG - Intronic
1200311454 X:155082576-155082598 ACATGTGCATGTGTGTATGTTGG - Intronic
1200954227 Y:8928871-8928893 TCATGTGCACCTCTCTGTGGAGG + Intergenic
1201676171 Y:16586957-16586979 GCTTGTGTGTGTGTGTGTGGCGG - Intergenic