ID: 1062328601

View in Genome Browser
Species Human (GRCh38)
Location 9:136025134-136025156
Sequence CAGGCTTTCAGCTGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062328597_1062328601 3 Left 1062328597 9:136025108-136025130 CCAAGAGGAGGGGTTCTGGGGAA 0: 1
1: 0
2: 2
3: 25
4: 296
Right 1062328601 9:136025134-136025156 CAGGCTTTCAGCTGAGGCCCTGG No data
1062328593_1062328601 7 Left 1062328593 9:136025104-136025126 CCAGCCAAGAGGAGGGGTTCTGG 0: 1
1: 0
2: 2
3: 16
4: 172
Right 1062328601 9:136025134-136025156 CAGGCTTTCAGCTGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062328601 Original CRISPR CAGGCTTTCAGCTGAGGCCC TGG Intronic
No off target data available for this crispr