ID: 1062331677

View in Genome Browser
Species Human (GRCh38)
Location 9:136047646-136047668
Sequence CTGAGTACGGGGGAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062331659_1062331677 17 Left 1062331659 9:136047606-136047628 CCCCACCCCTCAGCCCCAATGGG 0: 1
1: 0
2: 1
3: 38
4: 326
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331661_1062331677 16 Left 1062331661 9:136047607-136047629 CCCACCCCTCAGCCCCAATGGGA 0: 1
1: 0
2: 2
3: 14
4: 203
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331663_1062331677 12 Left 1062331663 9:136047611-136047633 CCCCTCAGCCCCAATGGGACTGT 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331664_1062331677 11 Left 1062331664 9:136047612-136047634 CCCTCAGCCCCAATGGGACTGTA 0: 1
1: 0
2: 4
3: 89
4: 455
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331666_1062331677 4 Left 1062331666 9:136047619-136047641 CCCCAATGGGACTGTACCTCGTG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331667_1062331677 3 Left 1062331667 9:136047620-136047642 CCCAATGGGACTGTACCTCGTGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331662_1062331677 15 Left 1062331662 9:136047608-136047630 CCACCCCTCAGCCCCAATGGGAC 0: 1
1: 0
2: 0
3: 16
4: 235
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331657_1062331677 29 Left 1062331657 9:136047594-136047616 CCTTGAGGGTGTCCCCACCCCTC 0: 1
1: 0
2: 5
3: 33
4: 292
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331665_1062331677 10 Left 1062331665 9:136047613-136047635 CCTCAGCCCCAATGGGACTGTAC 0: 1
1: 0
2: 1
3: 14
4: 258
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data
1062331668_1062331677 2 Left 1062331668 9:136047621-136047643 CCAATGGGACTGTACCTCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062331677 Original CRISPR CTGAGTACGGGGGAGTTGGA GGG Intronic
No off target data available for this crispr