ID: 1062332297

View in Genome Browser
Species Human (GRCh38)
Location 9:136050042-136050064
Sequence GACGTAGGGGGCCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062332292_1062332297 -10 Left 1062332292 9:136050029-136050051 CCGAGGGGGACACGACGTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1062332297 9:136050042-136050064 GACGTAGGGGGCCGCGGCGGCGG 0: 1
1: 0
2: 1
3: 25
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062332297 Original CRISPR GACGTAGGGGGCCGCGGCGG CGG Exonic
900237590 1:1600111-1600133 GTCGGAGCGGGCGGCGGCGGAGG - Intergenic
900265287 1:1754155-1754177 GGCGTATGCGGCCGCGGCCGGGG - Exonic
900284093 1:1891018-1891040 GACGGAGGCGGCGGCGGCGGCGG - Exonic
901086216 1:6613800-6613822 GCTGCAGGGGGCGGCGGCGGCGG - Exonic
901887032 1:12230338-12230360 GACGCAGGGGTCCCCGGAGGTGG - Intronic
903115629 1:21176576-21176598 GGCGGAGGCGGCGGCGGCGGCGG - Intronic
903390678 1:22961649-22961671 GACGTAGGGGCCAGGTGCGGTGG - Intronic
903777138 1:25800346-25800368 GACGGCGGCGGCAGCGGCGGCGG - Exonic
903907518 1:26696888-26696910 GAAGACGGCGGCCGCGGCGGCGG - Exonic
905212778 1:36385868-36385890 GAGGGAGGCGGCGGCGGCGGCGG - Exonic
905449223 1:38046412-38046434 GACGACGGCGGCGGCGGCGGAGG - Exonic
906640506 1:47438217-47438239 GACGTGGTGGGCGGCGGCAGCGG + Exonic
907126625 1:52056281-52056303 GACGGCGGCGGCGGCGGCGGCGG - Exonic
907126626 1:52056284-52056306 GACGACGGCGGCGGCGGCGGCGG - Exonic
907305356 1:53509953-53509975 GAGGATGGGGGCAGCGGCGGTGG + Exonic
908355784 1:63323852-63323874 GCCGTAGGGTCCCGCGGCGCCGG - Exonic
910374495 1:86553517-86553539 GAAGCAGGCGGCAGCGGCGGTGG - Intronic
912030977 1:105243240-105243262 GATGTAGGGGGCTGCTGCTGAGG + Intergenic
912305206 1:108560117-108560139 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
912515073 1:110211992-110212014 GACGGAGGCGGCAGCGGCGCGGG + Exonic
914855402 1:151346880-151346902 GACGTAGGGGCCGGCGACGTGGG - Intronic
914889754 1:151612250-151612272 AACGGAGGTGGCGGCGGCGGCGG + Exonic
915200114 1:154220995-154221017 GGCGTTGGCGGCGGCGGCGGCGG + Intronic
915214105 1:154328768-154328790 GGCATGGGGGGCGGCGGCGGCGG + Intronic
916507966 1:165445154-165445176 GACGGCGGCGGCGGCGGCGGCGG - Exonic
917530293 1:175829159-175829181 GACATGGGGGGCGGCGGCTGGGG - Intergenic
919724548 1:200873313-200873335 GCCGCTGTGGGCCGCGGCGGCGG + Exonic
920528488 1:206685284-206685306 GGGGTGGGGGGCTGCGGCGGCGG - Exonic
922558195 1:226548931-226548953 GACGGCGGCGGCGGCGGCGGCGG + Exonic
922809707 1:228408711-228408733 GAGGTAGGGGTACGCGGAGGTGG + Exonic
923141429 1:231163563-231163585 GACGTCTGCAGCCGCGGCGGTGG + Exonic
923684231 1:236142723-236142745 CACGTAGGGGGGCACGGCCGGGG - Exonic
924052289 1:240091768-240091790 GGCAGAGGGGGCGGCGGCGGCGG + Intronic
924052422 1:240092260-240092282 GGGGGAGGGGGCGGCGGCGGCGG + Exonic
924355042 1:243164136-243164158 GATATACGGGGCAGCGGCGGTGG - Intronic
1064287998 10:14009617-14009639 GGCGAAGGGTGCCACGGCGGCGG + Intronic
1066402593 10:35090268-35090290 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
1068204175 10:53827432-53827454 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
1072562230 10:96586893-96586915 GGCGGAGGCGGCGGCGGCGGAGG - Exonic
1072891518 10:99329387-99329409 GATGGCGGCGGCCGCGGCGGCGG + Exonic
1074865453 10:117542226-117542248 GATTCAGGGGGCCGCAGCGGAGG + Intergenic
1074995550 10:118754632-118754654 GACGAGGGGGGCGGCGGAGGTGG + Exonic
1076727764 10:132421420-132421442 GAAGTAGGGGGCTGCAGCTGGGG + Intergenic
1076757307 10:132579238-132579260 GACGGAGGGGACCGCGGGGCGGG + Intronic
1077043671 11:535299-535321 GGCGTAAGCGGCGGCGGCGGCGG - Intronic
1077085380 11:747454-747476 GACCGAGGGGTCTGCGGCGGCGG - Exonic
1077120811 11:907520-907542 GGGGTTGGGGGCAGCGGCGGTGG + Intronic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1077253754 11:1571812-1571834 GGCGGAGGGCGCCGCGTCGGGGG - Intronic
1082795800 11:57376974-57376996 GACATAGGGGGCCCCTGAGGAGG - Intronic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083721943 11:64607655-64607677 CAGGTTGGGGGCCGGGGCGGAGG + Exonic
1083753698 11:64778079-64778101 GGCGGAGGGGGCGGCTGCGGCGG + Exonic
1083753727 11:64778157-64778179 GGCGGAGGGGGCGGCGGCGGAGG + Exonic
1084031324 11:66482355-66482377 GATGTAGGGGGCCTCAGGGGAGG - Exonic
1084790801 11:71474295-71474317 GACCTAGCGGGACTCGGCGGAGG + Intronic
1084968048 11:72754666-72754688 GACGCAGGGGACCGCGGCAGCGG + Intronic
1085597168 11:77820687-77820709 GACGGCGGCGGCAGCGGCGGCGG - Exonic
1088400879 11:109422128-109422150 GGCGAAGGCGGCGGCGGCGGCGG + Exonic
1090635806 11:128689871-128689893 TACGTGGGAGGCCGCGGCGGCGG - Intronic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1095687194 12:45050347-45050369 GGAGTAGGGGGCCCAGGCGGAGG - Intronic
1096078363 12:48818507-48818529 CACCTACGGGGCCGTGGCGGCGG - Intronic
1096695325 12:53344996-53345018 GGGGGAGGGGGCGGCGGCGGGGG + Intronic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097264617 12:57738143-57738165 GACGGAGAAGGCGGCGGCGGAGG + Exonic
1097793973 12:63843673-63843695 GAGGTGCGGGGCCTCGGCGGAGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100992647 12:100267246-100267268 GACGTTTGCGGCCGCGGGGGCGG + Intronic
1102370952 12:112382101-112382123 CTCGTCGGCGGCCGCGGCGGCGG - Intronic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1102915640 12:116750046-116750068 GAAGGAGGGGGCCGGGGCGAGGG + Exonic
1102973604 12:117190387-117190409 GGCGGAGGAGGCCGCGCCGGAGG - Exonic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1104918338 12:132277984-132278006 GGGGGAGGGGGCCGGGGCGGGGG - Intronic
1104927636 12:132321937-132321959 GGTGCAGGGGGCCGAGGCGGGGG - Intronic
1105407329 13:20143162-20143184 GGTGCTGGGGGCCGCGGCGGAGG - Exonic
1106269486 13:28139102-28139124 GGCGGGGCGGGCCGCGGCGGCGG + Intronic
1106995833 13:35478726-35478748 GGCGCAGGGGCCCGCGGCTGGGG - Intronic
1111676811 13:91398654-91398676 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
1111975995 13:94967940-94967962 GACGCACGGGGCAGCCGCGGAGG + Intergenic
1114270677 14:21098330-21098352 GGCGGAGCGGGCGGCGGCGGCGG + Exonic
1114659433 14:24335105-24335127 GTGGGAGGGGGCCGCGGCGCCGG - Intronic
1115642268 14:35342218-35342240 GGCGAATGGGGCTGCGGCGGAGG - Intergenic
1117920615 14:60723031-60723053 GAGGTAGGGGGCGGCGGAGGCGG - Intronic
1119003890 14:70907488-70907510 GCCGGCGGGGGTCGCGGCGGCGG + Exonic
1119226997 14:72951949-72951971 GAAGTATGGGGCCGCTGCAGAGG + Intronic
1119649914 14:76376253-76376275 GGAGGAGGCGGCCGCGGCGGGGG - Intronic
1121279387 14:92688184-92688206 GACGGTGGTGGCGGCGGCGGCGG + Exonic
1122486599 14:102086605-102086627 TTCGTTGGGGACCGCGGCGGGGG - Intronic
1122558292 14:102592960-102592982 GGCGGAGGCGGCGGCGGCGGAGG - Exonic
1122558300 14:102592981-102593003 GGCGCAGGCGGCCGAGGCGGCGG - Exonic
1123630772 15:22258276-22258298 GGCGCCGGGGGCCGCGGCCGGGG - Intergenic
1124971144 15:34490540-34490562 CACGGAGGCGGCGGCGGCGGCGG - Intergenic
1125516611 15:40324316-40324338 GACTTCGGGGGCGGCGGCGGCGG + Intergenic
1125536111 15:40441750-40441772 GAGGCAAGGGGCCGCGGCCGGGG + Intronic
1128119226 15:65133507-65133529 GGCGGAGGAGGCAGCGGCGGTGG + Exonic
1128322514 15:66703325-66703347 GAGGAAGGCGGCAGCGGCGGCGG + Exonic
1129082350 15:73052304-73052326 GACGGCGGGGGCGGGGGCGGGGG - Intronic
1129916949 15:79282674-79282696 GAAGGAGGGGGCCGCGGGGGTGG - Intergenic
1130002489 15:80059687-80059709 GACGGAGGGGCCGGCGGTGGCGG + Exonic
1130348051 15:83067057-83067079 GACGGTGAGGGCGGCGGCGGCGG + Exonic
1131060177 15:89399754-89399776 GAGGGAGGGGGACGCGGCGTAGG + Intergenic
1131692814 15:94845084-94845106 GAAGCAGCGGGCGGCGGCGGCGG - Intergenic
1132186651 15:99806846-99806868 GACGGTGGGGCGCGCGGCGGCGG + Intergenic
1132429036 15:101745865-101745887 GACGGTGGGGCGCGCGGCGGCGG - Intergenic
1132570520 16:642073-642095 GACGGGGCGGGGCGCGGCGGCGG + Intronic
1133051600 16:3120268-3120290 GATGCTGGGGGCGGCGGCGGCGG + Exonic
1133219853 16:4315494-4315516 GATGGAGGAGGTCGCGGCGGCGG - Intronic
1133634653 16:7653839-7653861 TCGGTAGGCGGCCGCGGCGGTGG - Exonic
1135735819 16:24931137-24931159 TGCGTAGGGGGCTGCGGCGGTGG + Exonic
1136239906 16:28937386-28937408 GAGGTGGGGGGCCACGGGGGAGG - Intronic
1136555565 16:31005880-31005902 GACTTAGGGGGCCCCTGAGGAGG - Intronic
1137617270 16:49855521-49855543 GGCGGAGGCGGCGGCGGCGGCGG - Intronic
1138465398 16:57186405-57186427 GAGGGAGGGGGCGGCGGCGGCGG - Exonic
1139631844 16:68236014-68236036 GGGGGAGGGGGCGGCGGCGGCGG + Exonic
1139917808 16:70439028-70439050 GACGGCGGCGGCGGCGGCGGCGG - Intronic
1139917809 16:70439031-70439053 GACGACGGCGGCGGCGGCGGCGG - Intronic
1141436394 16:84002116-84002138 GAAGTAGGGGGCCGTGGAGGGGG - Intronic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141972272 16:87492297-87492319 GGCGCCGGGGGCCGCGGCCGGGG + Intergenic
1142144938 16:88489045-88489067 GATGTGGGGGGCGGCAGCGGTGG - Exonic
1142836956 17:2594135-2594157 GAAGGAGGAGGCGGCGGCGGAGG - Intronic
1143148317 17:4790375-4790397 TACGGAGGCGGCCGCGGCGCGGG - Exonic
1143269590 17:5665838-5665860 GACTGAGGGGGGCGCTGCGGGGG - Intergenic
1143548576 17:7614766-7614788 GACGAAGGCAGCGGCGGCGGCGG - Exonic
1143590784 17:7885059-7885081 GGCGGCGGGGGCGGCGGCGGCGG - Exonic
1143830305 17:9645686-9645708 GGCGCAGGGAGCGGCGGCGGCGG - Exonic
1145259566 17:21346721-21346743 GACCTAGGGGTCCGGGGTGGGGG - Intergenic
1146255886 17:31391533-31391555 GGCGGCGGGGGCGGCGGCGGCGG - Intergenic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146393609 17:32444482-32444504 GGCGTCGGCGGCCGCGGCCGGGG + Exonic
1146398560 17:32487009-32487031 GACGGCGGCGGCGGCGGCGGCGG - Exonic
1147429561 17:40363076-40363098 GGCGGAGGTGGCGGCGGCGGCGG + Exonic
1147742519 17:42677029-42677051 GAGGGAGGGGGCCGGGGGGGCGG - Intergenic
1148001884 17:44393191-44393213 TACGTTGGGGGCTGCGGTGGGGG + Intergenic
1148060085 17:44830177-44830199 GGCGAAGGCGGCAGCGGCGGAGG - Intronic
1148081456 17:44969346-44969368 GAGTTAGGGGGCGGCGGAGGAGG - Intergenic
1148337551 17:46851691-46851713 GAAGTAGGAGGCGGCGGCGGCGG - Exonic
1148437173 17:47693985-47694007 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1148786835 17:50149729-50149751 GACGGGGCGGGCGGCGGCGGCGG + Exonic
1148787162 17:50151006-50151028 GAGGGAGGGAGGCGCGGCGGCGG - Intergenic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150675808 17:67245262-67245284 GCCGGAGGGGGCGGCGCCGGCGG - Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1152049142 17:77958952-77958974 GTCCTAGGCGGCGGCGGCGGCGG - Intergenic
1152214490 17:79024492-79024514 GAGGTAGGTGGCCGGGCCGGGGG + Exonic
1152352960 17:79793528-79793550 CACGGAGGGAGGCGCGGCGGCGG - Exonic
1152612844 17:81323988-81324010 GGAGTGGGGGGCCGCGCCGGGGG + Intronic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1153805384 18:8705591-8705613 GACGGCGGCGGCGGCGGCGGCGG - Intergenic
1153805385 18:8705594-8705616 GACGACGGCGGCGGCGGCGGCGG - Intergenic
1154954815 18:21242875-21242897 CAGGTAGGGCGCCGCGGAGGTGG + Intronic
1155392495 18:25351151-25351173 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1156698822 18:39799343-39799365 GCGGGAGGGGGCGGCGGCGGGGG + Intergenic
1157383933 18:47247070-47247092 GGCGGCGGGGGCGGCGGCGGCGG + Intronic
1157849134 18:51030707-51030729 GACGACGGCGGCGGCGGCGGCGG + Intronic
1157849135 18:51030710-51030732 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1158137592 18:54224219-54224241 GACGGCGGCGGCTGCGGCGGCGG - Exonic
1158436008 18:57435855-57435877 GGCGGCGGGGGCGGCGGCGGGGG + Exonic
1159045746 18:63367245-63367267 GCCGGGGCGGGCCGCGGCGGAGG + Exonic
1159798100 18:72867768-72867790 GACGGAGCGGGCGGCGGCGGCGG + Exonic
1159798236 18:72868229-72868251 GCAGAATGGGGCCGCGGCGGCGG + Intergenic
1160725740 19:617084-617106 GGCGTGGGGGGCCACGGTGGGGG - Exonic
1160738807 19:676598-676620 GACGTCGGGGGGCGCGGCGGCGG + Intronic
1160847778 19:1173995-1174017 GTCGGAAGGGGTCGCGGCGGAGG + Intronic
1160858817 19:1229115-1229137 GCCGCACGGGGCCTCGGCGGCGG - Exonic
1160930461 19:1567634-1567656 GACGGCCGGGGCGGCGGCGGCGG + Exonic
1160967696 19:1753825-1753847 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1160982744 19:1823733-1823755 GCCGTCGGGGGCCGGGCCGGGGG + Exonic
1161129821 19:2581293-2581315 GATGGGGGGGGCCGCGGGGGTGG + Intronic
1161350086 19:3786427-3786449 GGCGCCGGGGGCCGCGGAGGCGG - Intronic
1162070292 19:8148917-8148939 GAGGCAGGGGGCTGGGGCGGAGG - Intronic
1162478120 19:10913054-10913076 GACCTAGGAGGCCGCAGCAGGGG + Intronic
1162752684 19:12838510-12838532 GGCGGAGGCGGCGGCGGCGGCGG - Intronic
1162914073 19:13865179-13865201 GAGGGAGGGGGCGGCGGCAGCGG + Intronic
1163122010 19:15223787-15223809 GACGTCGGAGCCCGCGGCGGAGG - Intergenic
1163282315 19:16325330-16325352 GGCGGCGGGGGCGGCGGCGGCGG - Exonic
1163725151 19:18919177-18919199 GACGCTGGGGGCGGAGGCGGAGG - Intronic
1165242806 19:34481556-34481578 GACGCAGGGGCGGGCGGCGGAGG - Intergenic
1165472053 19:36009525-36009547 GAGGTGGTGGGCCGGGGCGGAGG + Exonic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1165760695 19:38319790-38319812 GAGGTGGGGGGCGGCGACGGAGG - Intergenic
1165796000 19:38519482-38519504 GACGTGGGAGGTCGGGGCGGAGG - Intronic
1165928609 19:39342441-39342463 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1166337439 19:42116871-42116893 GGCGGAGGCGGCGGCGGCGGCGG + Intronic
1166347725 19:42176793-42176815 GAGGGCCGGGGCCGCGGCGGCGG + Intronic
1167002814 19:46756004-46756026 GTCGCAGCGGGGCGCGGCGGGGG - Exonic
1167045370 19:47046142-47046164 GACGCTGGGGGGCGCGGCCGTGG - Exonic
1167072916 19:47230946-47230968 GCCGGAGGGGGCGGCGGTGGGGG + Intronic
1167258108 19:48443027-48443049 GACGGCGGTGGCCGCGGCGGCGG - Exonic
1167454530 19:49591461-49591483 GAGGGAGGGGGCAGGGGCGGAGG - Intergenic
1167547366 19:50136126-50136148 GACGTAGGGGGACGAGTTGGCGG + Intergenic
1167738638 19:51311596-51311618 GAGGTGGGGGGCCGGGGAGGCGG - Intergenic
1167924111 19:52809817-52809839 GGCGAAGGCGGCGGCGGCGGCGG + Intronic
1168026553 19:53647819-53647841 GAGGGAGGAGGCCGCGGCGGGGG - Intergenic
1168076346 19:53982595-53982617 GGCGCCGGGGGCGGCGGCGGAGG + Exonic
1168339129 19:55613820-55613842 GGGGGAGGGGGCTGCGGCGGGGG - Exonic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
926077215 2:9951326-9951348 GACGGCGGGGGCGGCGGGGGCGG + Intergenic
926089895 2:10043232-10043254 GGCGGAGGGGGCGGCGGGGGCGG - Intronic
926089905 2:10043250-10043272 GGCGGAGGGGGCGGCGGGGGCGG - Intronic
926268297 2:11345032-11345054 GTCAGCGGGGGCCGCGGCGGGGG - Intronic
929623998 2:43387650-43387672 GAGGCAGGGGGCGGAGGCGGGGG - Intronic
929654772 2:43719681-43719703 GACTTTGGAGGCCGAGGCGGTGG - Intronic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
933684712 2:85133697-85133719 GGCGGCGGGGGCGGCGGCGGCGG + Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
934763843 2:96869745-96869767 GGCGCGGGGAGCCGCGGCGGCGG - Intronic
935354698 2:102187587-102187609 GGAGTAGGCGGCGGCGGCGGTGG - Intronic
935592161 2:104853843-104853865 GGCGGAGGGGGCGGCGGGGGAGG + Intergenic
935592436 2:104855281-104855303 GCAGCCGGGGGCCGCGGCGGCGG + Intergenic
935592570 2:104855637-104855659 GGCGCAGGGGGCGGGGGCGGCGG + Exonic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936217986 2:110576880-110576902 GAGGGGGGGGGCGGCGGCGGCGG - Intronic
940344946 2:152619541-152619563 GGAGGAGGGGGCGGCGGCGGCGG - Exonic
946325332 2:218981913-218981935 GTCCTGGGCGGCCGCGGCGGCGG + Exonic
946921433 2:224585168-224585190 GGCGGCGGGGGCGGCGGCGGCGG + Exonic
947549783 2:231037835-231037857 GGCGGCGGGGGCGGCGGCGGCGG + Exonic
947593026 2:231395831-231395853 GCCGTCGGGGGCCTGGGCGGGGG + Intronic
947741685 2:232487665-232487687 GACGGAAGTGGCCGCGGTGGTGG + Intronic
1170890036 20:20368679-20368701 CTCGGAGGGGGCGGCGGCGGCGG + Exonic
1172037335 20:32019227-32019249 CACGGAGGCGGCGGCGGCGGCGG + Exonic
1175429105 20:58890257-58890279 GTCGGCGGCGGCCGCGGCGGCGG - Intronic
1175938704 20:62527235-62527257 ACCGTAGGGGGCGGGGGCGGGGG - Intergenic
1176157012 20:63626999-63627021 GGCGTCGGGAGCTGCGGCGGCGG + Intronic
1176194649 20:63831473-63831495 GTCGCAGGGGGCCGCGCCGGGGG + Intergenic
1177163567 21:17575424-17575446 GACTTAGGAGGCCGTGGCAGGGG - Intronic
1177792783 21:25738213-25738235 GGGGCAGGGGGCGGCGGCGGCGG - Intronic
1178872153 21:36385686-36385708 GGGGTAGGGGACCGGGGCGGCGG - Intronic
1178961911 21:37073288-37073310 GCCGGAGGTGGCGGCGGCGGCGG + Intronic
1179586423 21:42376521-42376543 CAGGTACGGGGCCGCAGCGGTGG - Exonic
1179999097 21:44987077-44987099 GATGCTGGGGGCCGGGGCGGTGG + Intergenic
1180095922 21:45555292-45555314 GGCGCAGGGGGCGGCGGGGGCGG + Intergenic
1180096019 21:45555525-45555547 GGTGCAGGGGGCGGCGGCGGGGG + Intergenic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180949412 22:19714461-19714483 GGCGGAGCGGGCGGCGGCGGCGG + Exonic
1181813766 22:25421361-25421383 GCCGCAGGGGGCGGCGGCGTCGG - Intergenic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182445499 22:30387252-30387274 GACGGAGGCGGCGGCGGAGGCGG + Exonic
1183524954 22:38317359-38317381 GAGGGAGGCGGCGGCGGCGGCGG - Exonic
1183605915 22:38866641-38866663 GTCGTAGGGGGCGGCGGGGGCGG + Exonic
1184493745 22:44825541-44825563 GGCAGCGGGGGCCGCGGCGGTGG - Exonic
1184523844 22:45010011-45010033 GATGGAGCGGGCCGGGGCGGCGG + Intergenic
1184891018 22:47379231-47379253 GGCGAAGGAGGCGGCGGCGGAGG + Intergenic
1184891044 22:47379312-47379334 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891049 22:47379327-47379349 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891054 22:47379342-47379364 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1184891060 22:47379360-47379382 GGCGGAGGCGGCGGCGGCGGAGG + Intergenic
1185055291 22:48575933-48575955 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1185335793 22:50270381-50270403 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
950495485 3:13331594-13331616 GACATAGGGTGCCCCGGAGGAGG - Intronic
951080360 3:18444922-18444944 GGGGGAGGGGGCGGCGGCGGGGG + Intronic
951439328 3:22705085-22705107 GGCTTAGGGGGCGGCGGCAGGGG + Intergenic
952408310 3:33025611-33025633 GAGGTCGTGGGCCGTGGCGGTGG + Intronic
952408323 3:33025670-33025692 GAGGTCGTGGGCCGTGGCGGTGG + Intronic
952408336 3:33025729-33025751 GAGGTCGTGGGCCGTGGCGGTGG + Intronic
953801081 3:46023117-46023139 GCCGTGCGGGGTCGCGGCGGCGG + Intronic
953912192 3:46898838-46898860 CACGTAGCCGGCAGCGGCGGTGG - Exonic
955768561 3:62369041-62369063 GACCCAGGAGGCGGCGGCGGCGG + Intergenic
955769242 3:62372537-62372559 GGCGGAGGCGGCGGCGGCGGTGG - Exonic
960960610 3:123067735-123067757 GACGTAGCCCGCCCCGGCGGAGG + Intronic
962277960 3:134030048-134030070 GTCTGAGGGGGCGGCGGCGGCGG - Exonic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
968415809 4:432757-432779 GACCTCGGGGGGCGGGGCGGGGG - Intronic
968775382 4:2536821-2536843 GGCTGAGGCGGCCGCGGCGGCGG - Intronic
968850578 4:3075027-3075049 GGCGGCGGGGGCGGCGGCGGGGG - Exonic
972265341 4:37454009-37454031 GACGGCGGCGGCGGCGGCGGCGG - Intronic
973279217 4:48341710-48341732 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
974549114 4:63349207-63349229 GACGTAGCAGGCCGGGGCTGAGG - Intergenic
974626153 4:64431066-64431088 GATGTAGGGGGCCTCAGGGGAGG - Intergenic
975985956 4:80202063-80202085 GACCACGGGGGCGGCGGCGGCGG + Exonic
976177956 4:82373558-82373580 GACACAGGGGGCAGCGGCGGCGG - Exonic
980130070 4:128809981-128810003 GACGGCGGCGGCGGCGGCGGCGG + Intronic
985462680 4:190121772-190121794 GACGGAGGCGGGCGCGGCGCAGG - Intergenic
985462686 4:190121801-190121823 GACGGAGGCGGGCGCGGCGCAGG - Intergenic
985532681 5:443212-443234 GGCGGAGGGGGCGGCGGGGGCGG + Exonic
985532684 5:443221-443243 GGCGGCGGGGGCGGCGGCGGCGG + Exonic
987132379 5:14871716-14871738 GACGGCGGCGGCGGCGGCGGCGG + Exonic
987258269 5:16179475-16179497 GGCGTCGGCGGCGGCGGCGGGGG + Exonic
988470397 5:31532239-31532261 GACGTAGGGGGAGGGGGCGCGGG - Intergenic
988609539 5:32711858-32711880 GGCGTTGGCGGCGGCGGCGGTGG + Exonic
990545130 5:56815274-56815296 GGCGGAGGGGGCGGGGGCGGAGG - Intergenic
992052516 5:72954574-72954596 GAAGGGGGGGGGCGCGGCGGTGG + Intergenic
992105726 5:73448043-73448065 GCCGGTGGGGGCGGCGGCGGCGG - Exonic
993651649 5:90529559-90529581 GACGTTGGCGGCAGAGGCGGAGG - Exonic
993900977 5:93584321-93584343 GGCGGAGGCGGCGGCGGCGGCGG - Exonic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
994197481 5:96936129-96936151 GCTGTAAGGAGCCGCGGCGGGGG + Exonic
995106241 5:108381024-108381046 GGCGGCGGGGGCTGCGGCGGCGG - Exonic
996398787 5:123037110-123037132 GAACTCGGCGGCCGCGGCGGAGG - Intergenic
996442952 5:123512482-123512504 GCCGGCGGGGGCAGCGGCGGCGG - Intronic
1000279897 5:159773401-159773423 GACGTCTGCGGCGGCGGCGGCGG + Intergenic
1001296726 5:170503992-170504014 GGCGGAGGGGGCGGCGGAGGGGG - Intronic
1006558560 6:34889493-34889515 GGCTTTGGGGGCGGCGGCGGCGG + Exonic
1007444676 6:41895552-41895574 GGCGTAAGGGGCGGCGGCGTAGG + Intergenic
1007781573 6:44257547-44257569 GGCGGAGGGGGCCGCGGGGAGGG - Exonic
1007978942 6:46130368-46130390 GAGGTGGCGGGCCGAGGCGGAGG + Intronic
1010703432 6:79078268-79078290 GGCGGAGGGATCCGCGGCGGAGG - Intergenic
1012245779 6:96924463-96924485 GACGGCGGGGGCGGGGGCGGGGG + Intergenic
1013793528 6:113859852-113859874 GGCCTCGGGGGCAGCGGCGGCGG - Exonic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1015149122 6:130019373-130019395 GGCGGAGGGGGCCGCAGGGGCGG - Intronic
1015496892 6:133891667-133891689 GAGGTAAGTGGCCGTGGCGGAGG - Intronic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1019472801 7:1230202-1230224 GAGGGAGGGGGCGGGGGCGGGGG + Intergenic
1019506762 7:1395261-1395283 GACGTCAGGGGCCGCTGGGGTGG + Intergenic
1019562505 7:1665672-1665694 GGGGGCGGGGGCCGCGGCGGGGG - Intergenic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1019765010 7:2843778-2843800 CACGGAGGGGCCCGGGGCGGGGG + Intronic
1020034887 7:4958916-4958938 GAGGGAGGGGCGCGCGGCGGCGG - Intronic
1020256267 7:6504389-6504411 GCCGTAGGGGGCCGGGGCAGGGG + Intronic
1020274294 7:6615499-6615521 GACGGCGGCGGCGGCGGCGGGGG + Intergenic
1021451246 7:20785323-20785345 GGCGGCGGGGGCGGCGGCGGCGG - Exonic
1022101088 7:27169594-27169616 GGCGGAGGCGGCGGCGGCGGCGG - Intronic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022350635 7:29564098-29564120 GTCGGAGGGGGCGGCGGCGAGGG - Exonic
1022509067 7:30923651-30923673 CACGTAGGGGGCAGGGGCAGGGG + Exonic
1025916925 7:65873342-65873364 GAGGGAGGCGGCGGCGGCGGCGG + Intronic
1027539888 7:79453606-79453628 GGCGTCGGCGGCGGCGGCGGCGG + Intergenic
1028540849 7:91940875-91940897 GACGAAGATGGCGGCGGCGGCGG + Exonic
1029456214 7:100673836-100673858 GGCGGAGGCGGCGGCGGCGGCGG - Exonic
1029461136 7:100694367-100694389 GAGGGAGGCGGCGGCGGCGGCGG - Intergenic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1031134835 7:117873340-117873362 CGCGGCGGGGGCCGCGGCGGAGG - Exonic
1032125333 7:129189057-129189079 GACCTCGGCGGCCGCGGAGGCGG - Exonic
1032345163 7:131110040-131110062 GAAGGAGGCGGCGGCGGCGGCGG + Intergenic
1034441151 7:151086677-151086699 GGCGGAGGCGGCGGCGGCGGCGG - Intronic
1034455402 7:151167490-151167512 AACGGCGGGGGCGGCGGCGGGGG - Exonic
1034494187 7:151410224-151410246 GACCCAGGCGGCGGCGGCGGAGG - Intronic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037977609 8:23224673-23224695 GAGAGAGGGGGACGCGGCGGGGG - Intronic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1042241296 8:66666927-66666949 AACGGAGGCGGCGGCGGCGGCGG + Exonic
1045029047 8:98117568-98117590 GACGTAGGGGGCTCCAGCGCAGG - Intronic
1045582982 8:103499968-103499990 GACCCAAGGGGCGGCGGCGGTGG + Intergenic
1048214289 8:132480980-132481002 GAGGGAGGAGGCGGCGGCGGCGG - Intergenic
1048244143 8:132775401-132775423 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
1049746959 8:144267085-144267107 GGCGGCGGGGGCGGCGGCGGGGG - Exonic
1049761482 8:144333791-144333813 GCCGTCGGGGGCCGCCGCCGAGG + Exonic
1049762267 8:144336888-144336910 GACGGCGGCGGCGGCGGCGGCGG + Intergenic
1050472619 9:6008213-6008235 CCCGGAGGGGGCCGCAGCGGCGG + Intergenic
1055514161 9:77020150-77020172 GGCGGCGGGGGCGGCGGCGGCGG - Exonic
1060087302 9:120714263-120714285 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1060917115 9:127397913-127397935 GACCCTGGGTGCCGCGGCGGGGG + Exonic
1061280802 9:129596952-129596974 GAGGCAGGGGGCCGGGGAGGAGG + Intergenic
1062332297 9:136050042-136050064 GACGTAGGGGGCCGCGGCGGCGG + Exonic
1186194868 X:7100032-7100054 GTGGTAGGGGGCCGGGGAGGGGG - Intronic
1186426036 X:9465001-9465023 GAGGGAGGGGCCGGCGGCGGGGG + Exonic
1186607966 X:11111350-11111372 GAGGAAGGCGGCGGCGGCGGCGG + Exonic
1189308675 X:40005712-40005734 AACGGAGGGGGCCGGGCCGGAGG - Intergenic
1189534589 X:41923446-41923468 GAGGGAGGTGGCGGCGGCGGCGG + Intronic
1190285376 X:48957720-48957742 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1192544813 X:72004660-72004682 GCGGTAGGGGGCTGCGGGGGTGG - Intergenic
1192925023 X:75747169-75747191 GCCGGAGGTGGCGGCGGCGGCGG - Intergenic
1193743279 X:85244118-85244140 CACGGAGGCGGCGGCGGCGGCGG + Exonic
1195239268 X:102935031-102935053 GTCGGAGGGGGCGGGGGCGGGGG + Intergenic
1197766153 X:130060569-130060591 GGCGGAGGCGGCCGCGGCCGCGG - Intergenic
1198767092 X:140091337-140091359 GACCGAGGCGGCGGCGGCGGCGG + Intergenic
1199445115 X:147912076-147912098 GGCGGAGGCGGCGGCGGCGGCGG + Exonic
1200092479 X:153642407-153642429 GGCGGAGGAGGCAGCGGCGGCGG + Intergenic
1200227808 X:154428782-154428804 GTCGTTGGCGGCGGCGGCGGCGG + Exonic
1200292602 X:154886790-154886812 GAGGCAGAGGGCGGCGGCGGCGG - Exonic
1200339446 X:155382530-155382552 GAGGCAGAGGGCGGCGGCGGCGG - Exonic
1200347024 X:155458163-155458185 GAGGCAGAGGGCGGCGGCGGCGG + Exonic