ID: 1062335116

View in Genome Browser
Species Human (GRCh38)
Location 9:136061517-136061539
Sequence CTGGGGTAGGGGAAGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335099_1062335116 25 Left 1062335099 9:136061469-136061491 CCCATGGCATTTGGCCGCAGGAA 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG No data
1062335100_1062335116 24 Left 1062335100 9:136061470-136061492 CCATGGCATTTGGCCGCAGGAAG 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG No data
1062335106_1062335116 11 Left 1062335106 9:136061483-136061505 CCGCAGGAAGGGGCTGGAGGCAG 0: 1
1: 0
2: 9
3: 83
4: 678
Right 1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335116 Original CRISPR CTGGGGTAGGGGAAGGCGGA TGG Intronic
No off target data available for this crispr