ID: 1062335129

View in Genome Browser
Species Human (GRCh38)
Location 9:136061595-136061617
Sequence GTCCAGGTGTGAGCCGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335129_1062335145 27 Left 1062335129 9:136061595-136061617 CCCTGTGCGGCTCACACCTGGAC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335129_1062335140 19 Left 1062335129 9:136061595-136061617 CCCTGTGCGGCTCACACCTGGAC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335129_1062335143 24 Left 1062335129 9:136061595-136061617 CCCTGTGCGGCTCACACCTGGAC No data
Right 1062335143 9:136061642-136061664 GCCTCAGCCCTCACACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335129 Original CRISPR GTCCAGGTGTGAGCCGCACA GGG (reversed) Intronic