ID: 1062335134

View in Genome Browser
Species Human (GRCh38)
Location 9:136061618-136061640
Sequence GGGGGCTGGGGTAGACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335134_1062335150 29 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335134_1062335140 -4 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335134_1062335145 4 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335134_1062335148 18 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335134_1062335143 1 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335143 9:136061642-136061664 GCCTCAGCCCTCACACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335134 Original CRISPR GGGGGCTGGGGTAGACCTGC TGG (reversed) Intronic