ID: 1062335137

View in Genome Browser
Species Human (GRCh38)
Location 9:136061632-136061654
Sequence TGAGGGCTGAGGCTGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335137_1062335150 15 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335137_1062335154 26 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335154 9:136061681-136061703 GTCAGAAAGAGGCAGATCGGAGG No data
1062335137_1062335153 23 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335153 9:136061678-136061700 CTGGTCAGAAAGAGGCAGATCGG No data
1062335137_1062335145 -10 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335137_1062335148 4 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335137 Original CRISPR TGAGGGCTGAGGCTGGGGGC TGG (reversed) Intronic