ID: 1062335140

View in Genome Browser
Species Human (GRCh38)
Location 9:136061637-136061659
Sequence CCCCAGCCTCAGCCCTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335132_1062335140 3 Left 1062335132 9:136061611-136061633 CCTGGACCCAGCAGGTCTACCCC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335130_1062335140 18 Left 1062335130 9:136061596-136061618 CCTGTGCGGCTCACACCTGGACC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335129_1062335140 19 Left 1062335129 9:136061595-136061617 CCCTGTGCGGCTCACACCTGGAC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335134_1062335140 -4 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
1062335133_1062335140 -3 Left 1062335133 9:136061617-136061639 CCCAGCAGGTCTACCCCAGCCCC No data
Right 1062335140 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335140 Original CRISPR CCCCAGCCTCAGCCCTCACA CGG Intronic