ID: 1062335141

View in Genome Browser
Species Human (GRCh38)
Location 9:136061638-136061660
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335141_1062335148 -2 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335141_1062335155 29 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335155 9:136061690-136061712 AGGCAGATCGGAGGTCTAGCAGG No data
1062335141_1062335150 9 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335141_1062335153 17 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335153 9:136061678-136061700 CTGGTCAGAAAGAGGCAGATCGG No data
1062335141_1062335154 20 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335154 9:136061681-136061703 GTCAGAAAGAGGCAGATCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335141 Original CRISPR GCCGTGTGAGGGCTGAGGCT GGG (reversed) Intronic