ID: 1062335144

View in Genome Browser
Species Human (GRCh38)
Location 9:136061643-136061665
Sequence ACCTGGCCGTGTGAGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335144_1062335148 -7 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335144_1062335153 12 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335153 9:136061678-136061700 CTGGTCAGAAAGAGGCAGATCGG No data
1062335144_1062335154 15 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335154 9:136061681-136061703 GTCAGAAAGAGGCAGATCGGAGG No data
1062335144_1062335156 30 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335156 9:136061696-136061718 ATCGGAGGTCTAGCAGGCTCAGG No data
1062335144_1062335150 4 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335144_1062335155 24 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335155 9:136061690-136061712 AGGCAGATCGGAGGTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335144 Original CRISPR ACCTGGCCGTGTGAGGGCTG AGG (reversed) Intronic