ID: 1062335145

View in Genome Browser
Species Human (GRCh38)
Location 9:136061645-136061667
Sequence TCAGCCCTCACACGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335130_1062335145 26 Left 1062335130 9:136061596-136061618 CCTGTGCGGCTCACACCTGGACC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335132_1062335145 11 Left 1062335132 9:136061611-136061633 CCTGGACCCAGCAGGTCTACCCC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335134_1062335145 4 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335133_1062335145 5 Left 1062335133 9:136061617-136061639 CCCAGCAGGTCTACCCCAGCCCC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335135_1062335145 -8 Left 1062335135 9:136061630-136061652 CCCCAGCCCCCAGCCTCAGCCCT No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335137_1062335145 -10 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335136_1062335145 -9 Left 1062335136 9:136061631-136061653 CCCAGCCCCCAGCCTCAGCCCTC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data
1062335129_1062335145 27 Left 1062335129 9:136061595-136061617 CCCTGTGCGGCTCACACCTGGAC No data
Right 1062335145 9:136061645-136061667 TCAGCCCTCACACGGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335145 Original CRISPR TCAGCCCTCACACGGCCAGG TGG Intronic