ID: 1062335148

View in Genome Browser
Species Human (GRCh38)
Location 9:136061659-136061681
Sequence GCCAGGTGGCAACATCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335139_1062335148 -1 Left 1062335139 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335134_1062335148 18 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335138_1062335148 0 Left 1062335138 9:136061636-136061658 CCCCCAGCCTCAGCCCTCACACG No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335137_1062335148 4 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335136_1062335148 5 Left 1062335136 9:136061631-136061653 CCCAGCCCCCAGCCTCAGCCCTC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335135_1062335148 6 Left 1062335135 9:136061630-136061652 CCCCAGCCCCCAGCCTCAGCCCT No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335141_1062335148 -2 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335132_1062335148 25 Left 1062335132 9:136061611-136061633 CCTGGACCCAGCAGGTCTACCCC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335144_1062335148 -7 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335142_1062335148 -3 Left 1062335142 9:136061639-136061661 CCAGCCTCAGCCCTCACACGGCC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data
1062335133_1062335148 19 Left 1062335133 9:136061617-136061639 CCCAGCAGGTCTACCCCAGCCCC No data
Right 1062335148 9:136061659-136061681 GCCAGGTGGCAACATCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335148 Original CRISPR GCCAGGTGGCAACATCCTCC TGG Intronic