ID: 1062335150

View in Genome Browser
Species Human (GRCh38)
Location 9:136061670-136061692
Sequence ACATCCTCCTGGTCAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062335136_1062335150 16 Left 1062335136 9:136061631-136061653 CCCAGCCCCCAGCCTCAGCCCTC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335147_1062335150 -3 Left 1062335147 9:136061650-136061672 CCTCACACGGCCAGGTGGCAACA No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335137_1062335150 15 Left 1062335137 9:136061632-136061654 CCAGCCCCCAGCCTCAGCCCTCA No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335139_1062335150 10 Left 1062335139 9:136061637-136061659 CCCCAGCCTCAGCCCTCACACGG No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335133_1062335150 30 Left 1062335133 9:136061617-136061639 CCCAGCAGGTCTACCCCAGCCCC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335134_1062335150 29 Left 1062335134 9:136061618-136061640 CCAGCAGGTCTACCCCAGCCCCC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335144_1062335150 4 Left 1062335144 9:136061643-136061665 CCTCAGCCCTCACACGGCCAGGT No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335138_1062335150 11 Left 1062335138 9:136061636-136061658 CCCCCAGCCTCAGCCCTCACACG No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335135_1062335150 17 Left 1062335135 9:136061630-136061652 CCCCAGCCCCCAGCCTCAGCCCT No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335146_1062335150 -2 Left 1062335146 9:136061649-136061671 CCCTCACACGGCCAGGTGGCAAC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335142_1062335150 8 Left 1062335142 9:136061639-136061661 CCAGCCTCAGCCCTCACACGGCC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data
1062335141_1062335150 9 Left 1062335141 9:136061638-136061660 CCCAGCCTCAGCCCTCACACGGC No data
Right 1062335150 9:136061670-136061692 ACATCCTCCTGGTCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062335150 Original CRISPR ACATCCTCCTGGTCAGAAAG AGG Intronic