ID: 1062338186

View in Genome Browser
Species Human (GRCh38)
Location 9:136081741-136081763
Sequence GCTGCTGCCGCCACTTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062338186_1062338198 17 Left 1062338186 9:136081741-136081763 CCCCACCAAGTGGCGGCAGCAGC 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1062338198 9:136081781-136081803 CCCTCTACCTGGATGGCACCTGG No data
1062338186_1062338194 6 Left 1062338186 9:136081741-136081763 CCCCACCAAGTGGCGGCAGCAGC 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1062338194 9:136081770-136081792 CTGACCAAGCTCCCTCTACCTGG No data
1062338186_1062338200 23 Left 1062338186 9:136081741-136081763 CCCCACCAAGTGGCGGCAGCAGC 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1062338200 9:136081787-136081809 ACCTGGATGGCACCTGGCCCAGG No data
1062338186_1062338196 10 Left 1062338186 9:136081741-136081763 CCCCACCAAGTGGCGGCAGCAGC 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1062338196 9:136081774-136081796 CCAAGCTCCCTCTACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062338186 Original CRISPR GCTGCTGCCGCCACTTGGTG GGG (reversed) Intronic
900113783 1:1020208-1020230 GCTGCTGCCGCTCCTTGTGGTGG + Exonic
900326868 1:2112525-2112547 GGTGCAGCCGCCGCTTGGAGCGG + Intronic
900513916 1:3072481-3072503 GCTGCAGCCCCCACTAGATGGGG + Intronic
900611019 1:3544716-3544738 GCTGGTGCCGGGCCTTGGTGGGG - Intronic
901030369 1:6304024-6304046 GCTGCAGCCTCCTCTTGCTGGGG - Intronic
903115525 1:21176265-21176287 GCTGCTGCCGCCGCCGGGTGAGG + Exonic
903906947 1:26694465-26694487 GCTGCTGCTGGGATTTGGTGGGG + Intergenic
904365438 1:30008131-30008153 GCTGCCGGTGCCACTGGGTGGGG - Intergenic
904895219 1:33812218-33812240 CCTGCTCCCTCCACTTGCTGTGG - Intronic
906252023 1:44318113-44318135 GCTGCTGCTGCTACTTTTTGTGG - Intronic
906877789 1:49557422-49557444 GCTGCTGCTGCCAGGTTGTGGGG - Intronic
907559544 1:55375834-55375856 TCTGCTGCCCCCTATTGGTGTGG - Intergenic
911116068 1:94247675-94247697 GCTGCGGCTGCCACTTGGCCGGG - Intronic
913333520 1:117686617-117686639 TGTGCTGCCTGCACTTGGTGGGG - Intergenic
913597609 1:120393788-120393810 TCTGCTGCCACCATGTGGTGAGG + Intergenic
914089721 1:144485526-144485548 TCTGCTGCCACCATGTGGTGAGG - Intergenic
914308889 1:146448690-146448712 TCTGCTGCCACCATGTGGTGAGG + Intergenic
914512438 1:148345800-148345822 TCTGCTGCCACCATGTGGTGAGG - Intergenic
914593220 1:149124441-149124463 TCTGCTGCCACCATGTGGTGAGG - Intergenic
914799126 1:150947171-150947193 GCTGCTGCTTCCACATGCTGTGG + Intronic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
916574574 1:166056078-166056100 GCTGCTCAGGCCACCTGGTGAGG + Intergenic
917937450 1:179882600-179882622 GCTGCTGCCGCCATTTTGAGGGG - Exonic
918122096 1:181549197-181549219 GCTGCTACAACCACCTGGTGTGG + Intronic
921263601 1:213404613-213404635 GCTTCACCCGCCACCTGGTGTGG - Intergenic
1066167377 10:32801840-32801862 GATGTTGCCACCACTTGGAGTGG + Intronic
1066343836 10:34562487-34562509 GCTGCTGATGCCACTTGGTGGGG - Intronic
1067890213 10:50128396-50128418 GCTGCTGTGGGAACTTGGTGCGG - Intronic
1070809323 10:79289682-79289704 GGAGCTGCGGTCACTTGGTGGGG + Intronic
1071273899 10:84035090-84035112 GGTGCAGCAACCACTTGGTGAGG + Intergenic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1073285037 10:102382441-102382463 GCTGTTGCTGCCACTTGGATGGG + Exonic
1073340858 10:102743684-102743706 GCTGCTTCCGCCACTCTCTGCGG + Intergenic
1075396016 10:122127556-122127578 GCTGCTGCCACCAGCTGCTGGGG - Intronic
1075468945 10:122673428-122673450 GCTGCTGCAGCAACTTCGGGAGG + Intergenic
1075519995 10:123137491-123137513 GCTGCCGCTTCCACTTGTTGCGG - Exonic
1075522254 10:123149901-123149923 GCTGCCGCTTCCACTTGTTGCGG - Exonic
1076332228 10:129678466-129678488 GCTGCTTCTGCCTCTTGGAGGGG + Intronic
1076792574 10:132785131-132785153 GCCGCTTGCGCCACTTGGTCCGG + Exonic
1077298071 11:1835237-1835259 GCTGCAGCCCCCACTTGGCTGGG - Intronic
1081989183 11:47328525-47328547 GCTGCTGCAGCCACTGTGAGAGG + Intronic
1082986071 11:59172332-59172354 GCTGCTGCCGCTGCTCTGTGGGG - Intronic
1083301804 11:61743580-61743602 GCTGCTGTCGCCAGTGGTTGCGG + Exonic
1083560748 11:63671304-63671326 GCAGCTGCTGCCACTCGCTGAGG + Exonic
1083640303 11:64141796-64141818 TCTGCTGCCCCCACATGGGGTGG - Intronic
1083717195 11:64584196-64584218 GCTGCTGGTGCCCCTCGGTGGGG - Intergenic
1084393056 11:68891085-68891107 CCTGCCGCCGCCACATGGGGTGG + Intergenic
1085273403 11:75283535-75283557 GCTGCTGCCGGCACTCTGGGGGG - Intronic
1088700269 11:112405258-112405280 GATGCTGCTGCCATTTAGTGAGG + Intergenic
1088929904 11:114341026-114341048 CCTGCAGCTGCCACTCGGTGGGG - Intergenic
1091043109 11:132300870-132300892 GCCTCTGCTGCCACTTGGAGTGG + Intronic
1091328824 11:134714392-134714414 GCTGCTCCCTCCACCTGGAGCGG + Intergenic
1091363704 11:134999696-134999718 ACTGCTGCCTCCACCTGGAGAGG - Intergenic
1093502528 12:19828467-19828489 GCTGCAGCCCCAACTTGGTAGGG + Intergenic
1095349136 12:41188712-41188734 GCGGCTGCGGCCACTCGGTCAGG + Exonic
1101095038 12:101329745-101329767 GCTGATGCCACCACTTTGGGAGG + Intronic
1103410738 12:120710150-120710172 GCTGCTGCTGCCACAGGGTTAGG - Intergenic
1105407364 13:20143359-20143381 GCTGCCGCCGCCCATGGGTGCGG - Intronic
1105601588 13:21892835-21892857 GCTGCTGCCGCATCTGTGTGGGG + Intergenic
1106350454 13:28924595-28924617 GCTGCTGCTGCCCCTCTGTGTGG + Intronic
1107590113 13:41894953-41894975 GCTGCTGCAGGGACTTGGTTGGG + Intronic
1108590930 13:51912361-51912383 GCTGCTGCCCCCACGTGATACGG - Intergenic
1115994474 14:39181541-39181563 GCTGCTGCTGCCACTTGTACTGG - Exonic
1118537421 14:66783268-66783290 CCTGCTGCCACCACCAGGTGAGG - Intronic
1119441116 14:74629417-74629439 GCTGCTGGTACCATTTGGTGTGG - Intergenic
1119821051 14:77616535-77616557 GCTGCTGCCGCCGCACGGTGCGG - Exonic
1122091756 14:99345618-99345640 GTTGCTGCGGCCACTATGTGTGG + Intergenic
1124629056 15:31326890-31326912 GCTGCGGCCGCGACTTGGCGAGG + Exonic
1129108768 15:73325476-73325498 GCTGCTGACGCCCCCTGGTGGGG - Intronic
1129517189 15:76163828-76163850 GCTGCTGCCACCACTGCCTGAGG - Intronic
1130274169 15:82468014-82468036 GCTGAGGCCTCCACTTGCTGGGG - Intergenic
1130588811 15:85199981-85200003 GCTGAGGCCTCCACTTGCTGGGG - Intergenic
1131049362 15:89335979-89336001 CCTGCTCCCGCCACGTGGAGAGG + Intergenic
1132205922 15:99986109-99986131 GCTGTGGCCCCCACTTGCTGTGG - Intronic
1132735456 16:1383826-1383848 GCTGCTGGAGCCACGTGGTGGGG - Intronic
1136088999 16:27904861-27904883 GCAGCTGCAGCCACCTGGAGGGG + Intronic
1136576295 16:31127337-31127359 GCTACCGCTTCCACTTGGTGAGG + Exonic
1137786521 16:51141760-51141782 GCTGCTGCTGCTGCTTGGGGCGG + Exonic
1138423018 16:56912183-56912205 GCTGGTGCCCCCACTTCATGCGG + Intronic
1142345039 16:89548501-89548523 GCTGCTGCCGCCCGTGGCTGTGG + Intronic
1142620085 17:1159975-1159997 GACGCTGCCGCCGCTTGGGGAGG + Intronic
1142799837 17:2337981-2338003 GCCGCTGCCGTCACTGGGCGGGG - Intronic
1143265512 17:5634171-5634193 GCTGCTGCCGCCACATGGGATGG + Intergenic
1145059201 17:19721511-19721533 GGTCTTGCCGCCACTTGCTGAGG - Intergenic
1147335182 17:39723391-39723413 TCTGCTGCCGTCGCTTGATGAGG - Exonic
1147721761 17:42543809-42543831 GCTGCTGCCGGCACTGGACGAGG + Exonic
1148824599 17:50383134-50383156 GCTGCTGCTGCTATTTGGTGTGG - Exonic
1150639718 17:66941379-66941401 GCTGCTGCTGCCACTTGGAAAGG - Intergenic
1151706706 17:75772998-75773020 GCTGCTGGGGCCATTTGGTTTGG + Intergenic
1152431149 17:80248827-80248849 GCTGCAGCAGCCACTGGCTGAGG - Intronic
1156102122 18:33609045-33609067 ACTGCTGCCTCCACTTTCTGGGG - Intronic
1156479812 18:37429053-37429075 TCTGCTGCCGTATCTTGGTGAGG + Intronic
1159997545 18:74980853-74980875 TCCGCTGCGGCCACTTGGAGAGG + Intronic
1160935502 19:1592722-1592744 GCCGCCGCCGCCACTTGCCGCGG + Intronic
1161089763 19:2353936-2353958 CCTGCTGGTGCCACCTGGTGGGG + Intronic
1161302460 19:3549283-3549305 GCTGCTGCTGCCACGGGGAGGGG - Intronic
1161802337 19:6423497-6423519 GCTGGTGCTGTCAGTTGGTGGGG - Intronic
1163015314 19:14450982-14451004 GCAGCAGCCGCCCCTTGGGGTGG - Exonic
1163144562 19:15371866-15371888 GCTGCTCCTGCCCCTTTGTGAGG + Intronic
1163604349 19:18265927-18265949 GCTGCTACCGCCACTTGGGGTGG + Exonic
1166380736 19:42353865-42353887 GCTGCTGCCTCCAGGTGGCGGGG + Exonic
1168719959 19:58549446-58549468 GCTGGTGCTGCCACTAGGTGAGG - Exonic
927072266 2:19543069-19543091 GCTGCTGCCGCCAATAGGTTAGG - Intergenic
927212338 2:20646499-20646521 GCTGCTGTCACCAACTGGTGAGG + Intronic
931516935 2:63055518-63055540 GCTGCTGGCGGCATTTGGCGCGG - Exonic
934912959 2:98275999-98276021 TCTGCTGCTGCCTCTTGGTCAGG + Intronic
938316483 2:130332720-130332742 ACTGGTGCTGCCACCTGGTGGGG + Intergenic
941625024 2:167822023-167822045 GCTGCTTCCTCCACTGTGTGGGG - Intergenic
942641607 2:178066730-178066752 GCTGCTGCCAGCTCTGGGTGAGG - Intronic
945221404 2:207488197-207488219 GCTGCAGCCGCCAGTAAGTGTGG + Intergenic
946084242 2:217155067-217155089 GCTGCAGTCGACACTGGGTGTGG + Intergenic
946370725 2:219279737-219279759 ACTGCTGCAGCCACAGGGTGGGG + Intronic
948590169 2:239044286-239044308 GCTGCTGTCTCCACTTGGACAGG + Intergenic
948876294 2:240831631-240831653 GCTGCAGCCGCCTCTCGGTGTGG - Intergenic
1170273413 20:14554352-14554374 GCTGCTGTCGCCACTTTGCTGGG + Intronic
1173105052 20:40125723-40125745 GCTGCTGCCTCCATTTGTTAAGG + Intergenic
1173893757 20:46534167-46534189 GCTCCTGCCCCAACTTGGAGGGG - Intergenic
1173960041 20:47063814-47063836 GCTGCTCCCACCACTCTGTGGGG + Intronic
1174111607 20:48201492-48201514 GCCGCTCCAGCCACCTGGTGTGG + Intergenic
1174169530 20:48607341-48607363 GCTACTCCAGCCACCTGGTGGGG - Intergenic
1175953366 20:62595759-62595781 GCTGCAGCCTCCACTGGGCGAGG + Intergenic
1181273472 22:21674145-21674167 GCAGCTGCTGCCACCTGGTGTGG - Intronic
1183050535 22:35257596-35257618 GCTGCTGCCGCCTCAGGGTGGGG - Intronic
1184679241 22:46061553-46061575 GCTGCGGCCGCCGCTTTGTTCGG - Intronic
949750990 3:7352746-7352768 GGTGCTGCTGCCACTAGGGGTGG - Intronic
953714063 3:45300962-45300984 GCTGCTGCCACCACTCAGTATGG - Intergenic
953798165 3:46001413-46001435 GCAGCTGCCACCAGTTGGTTTGG + Intergenic
954647555 3:52140751-52140773 GCTGGTGCGGCCAGTAGGTGAGG - Intronic
958181024 3:90061152-90061174 GCTGCTGCTGCCATTTGGACAGG + Intergenic
963065848 3:141263966-141263988 GTTACTTCAGCCACTTGGTGGGG + Intronic
965760403 3:172069263-172069285 GCTGCTGTCTCCACTTGAAGTGG + Intronic
968768098 4:2485184-2485206 GCTGCTGCTTCCACTTGCTTAGG + Intronic
968961916 4:3750006-3750028 GCTGGGCCCGCCACTTGGTTTGG - Intergenic
969483660 4:7459878-7459900 GCTTCTGCCCCCAATTGGTAGGG + Intronic
969715899 4:8867956-8867978 GCTGCCGCTTCCACTTGTTGCGG + Exonic
975006057 4:69287662-69287684 ACTGCTGCCTCCACTGGGAGGGG - Intronic
975734047 4:77364609-77364631 GATGTTGCCACCACTTGGGGGGG + Intronic
976389392 4:84493510-84493532 GCTTCTTCCTCCACTTGGTCCGG + Exonic
977853348 4:101857419-101857441 CCTGCTGCTGCCTCTTGCTGTGG + Intronic
978767853 4:112422840-112422862 GCTGAGGCCGCCACATGGAGAGG - Intronic
983143864 4:164188407-164188429 GATGCTGCTGCTACTCGGTGAGG + Intronic
985149376 4:186930275-186930297 GCTGCTGCCGCCCCTTTTCGGGG + Intergenic
986338407 5:6771053-6771075 GCTGTTGCCTCCACTGGTTGGGG + Intergenic
986778886 5:11046021-11046043 GCTGTTGGGGCTACTTGGTGTGG + Intronic
990990123 5:61675951-61675973 GGTGCGGCCACCACTTGGAGGGG + Intronic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
996257613 5:121425280-121425302 ACTGATGCCGCCTCTGGGTGAGG - Intergenic
998205178 5:140152640-140152662 GCTTCTGGGGCAACTTGGTGGGG + Intergenic
999122596 5:149220608-149220630 CCTGGTGTCCCCACTTGGTGAGG - Intronic
1002355658 5:178627025-178627047 GGCGCTGCCGCCATTTTGTGGGG - Exonic
1002448849 5:179307744-179307766 GCTGCTGCCTCCACCTGGAATGG + Intronic
1005456123 6:26021495-26021517 GCTGCTCCCGCCATTTCCTGGGG + Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1009703392 6:67213131-67213153 GCTGCTCAGGCCACTTGGTCTGG - Intergenic
1018254030 6:161900378-161900400 GATGCTGCTGCCACTGAGTGTGG + Intronic
1018431569 6:163726559-163726581 GCTGATGCCCAGACTTGGTGTGG + Intergenic
1018700686 6:166423685-166423707 GCTGCGGCCTCAACTTGGAGAGG - Intronic
1018880179 6:167869938-167869960 GCTGCTGCCATCGCTTTGTGTGG + Intronic
1019451391 7:1100517-1100539 CCAGCTGACGCCGCTTGGTGAGG - Intronic
1019586760 7:1809241-1809263 GCTCCTGCCGCCCCTTCCTGGGG - Intergenic
1021685880 7:23185145-23185167 TCTGCTGCCCCCCCATGGTGTGG - Exonic
1022793594 7:33714298-33714320 GCTGGTGCCGCTGCTGGGTGTGG - Intergenic
1023829608 7:44031081-44031103 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1029739916 7:102485339-102485361 GCTGCTGCCCCCAGAGGGTGGGG - Intronic
1029775851 7:102683579-102683601 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1032001357 7:128267559-128267581 GCTGCTGCCGCCAGGGGGTCCGG + Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1033104335 7:138506809-138506831 GCTGCTGGGGGCATTTGGTGAGG + Intronic
1033267519 7:139898715-139898737 CCTGCTGCTGCCACTTTGTCAGG - Intronic
1033420138 7:141198345-141198367 GCCGCTGCCACCTCTGGGTGTGG - Intronic
1034222805 7:149459552-149459574 GCGGCGGCCGCCCCTGGGTGAGG - Intronic
1035862683 8:3046951-3046973 GCTGATGCCGGCACTTTGGGAGG + Intronic
1037411355 8:18601640-18601662 CCTTCTGCCTCCACTAGGTGAGG + Intronic
1038334640 8:26636340-26636362 ACTGCTGCCCCCACGTAGTGTGG + Intronic
1039476480 8:37841694-37841716 GCCGCTGCTGCCGCTTGGGGAGG - Exonic
1040596837 8:48846817-48846839 GCAGCTGCCTGCACTTGGTCGGG + Intergenic
1041060577 8:54031000-54031022 TCTGCTGCAGCCAGTTGGTGGGG - Intergenic
1041823152 8:62062753-62062775 GCTGCTGCTGCCAGGGGGTGGGG - Intergenic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1047544059 8:125797988-125798010 CCTGCTGCATCAACTTGGTGGGG + Intergenic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1051203737 9:14662238-14662260 GCCGCTGCGGCCACTGTGTGAGG - Exonic
1052338272 9:27340929-27340951 GCTGCTGCTGCCCCTTGTTCTGG + Intronic
1057070168 9:92090787-92090809 GCTGCTCCTGCAACTAGGTGTGG + Intronic
1060531625 9:124350314-124350336 GCTGCTCCCGCCCCGAGGTGGGG - Intronic
1061128293 9:128690010-128690032 GCCGCCGCCGCCACATGGTGCGG + Intronic
1062338186 9:136081741-136081763 GCTGCTGCCGCCACTTGGTGGGG - Intronic
1062446336 9:136596921-136596943 GCTGCTGCCGCCTCCTCCTGGGG - Intergenic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1062521715 9:136960632-136960654 GGTGCTGCCTGCAGTTGGTGGGG + Intergenic
1190337339 X:49270289-49270311 GCTGCTGCCGCCTCCCGGAGCGG + Exonic
1192416528 X:70985985-70986007 GCTGTTGGCGCCATTTGGTAAGG + Intergenic
1193117153 X:77786189-77786211 GCTGCCGCCGCCATTTTGTTGGG + Exonic
1196214626 X:113035931-113035953 GCTGCTGCCGCCACTGCTGGGGG + Intergenic
1200131968 X:153854685-153854707 GGTGCTGCCAACACTTGGTGGGG + Intergenic