ID: 1062338308

View in Genome Browser
Species Human (GRCh38)
Location 9:136082201-136082223
Sequence GGGTGAAGACCCTGGGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 470}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062338308_1062338318 6 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338318 9:136082230-136082252 CCATCGGTGTGGCCACGCCACGG No data
1062338308_1062338319 14 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338319 9:136082238-136082260 GTGGCCACGCCACGGCCTGATGG No data
1062338308_1062338323 20 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338323 9:136082244-136082266 ACGCCACGGCCTGATGGAAGGGG No data
1062338308_1062338324 21 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338324 9:136082245-136082267 CGCCACGGCCTGATGGAAGGGGG No data
1062338308_1062338328 26 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338328 9:136082250-136082272 CGGCCTGATGGAAGGGGGCGGGG No data
1062338308_1062338313 -10 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338313 9:136082214-136082236 GTCTTCACCCTCAGGACCATCGG No data
1062338308_1062338314 -5 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338314 9:136082219-136082241 CACCCTCAGGACCATCGGTGTGG No data
1062338308_1062338322 19 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338322 9:136082243-136082265 CACGCCACGGCCTGATGGAAGGG No data
1062338308_1062338327 25 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338327 9:136082249-136082271 ACGGCCTGATGGAAGGGGGCGGG No data
1062338308_1062338326 24 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338326 9:136082248-136082270 CACGGCCTGATGGAAGGGGGCGG No data
1062338308_1062338321 18 Left 1062338308 9:136082201-136082223 CCGTCTCCCCAGGGTCTTCACCC 0: 1
1: 0
2: 2
3: 43
4: 470
Right 1062338321 9:136082242-136082264 CCACGCCACGGCCTGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062338308 Original CRISPR GGGTGAAGACCCTGGGGAGA CGG (reversed) Intronic
900084690 1:886330-886352 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
900166986 1:1247778-1247800 GGTGGAGGACCCTGGGGACACGG + Intergenic
900405098 1:2489523-2489545 GAGTGACCACCATGGGGAGATGG - Intronic
900540475 1:3200191-3200213 GAGTCAAGGGCCTGGGGAGAGGG + Intronic
900667137 1:3823153-3823175 AGGTGAGGGGCCTGGGGAGAAGG - Exonic
901231923 1:7646302-7646324 GGGTGGAGGCCCTGGTGAGTTGG + Intronic
901231993 1:7646562-7646584 GGGTGGAGGCCCTGGTGAGTTGG + Intronic
901448819 1:9323959-9323981 GGGTGCAGACCCGGAGGAGGTGG + Intronic
901934619 1:12618803-12618825 GGGGGAAGCCGCTGGGGAGCAGG + Intergenic
902388432 1:16089009-16089031 GGGGCAAGACCCAGGGGAAAGGG + Intergenic
902695701 1:18139447-18139469 GGCCGAAGACACTGGGAAGAGGG - Intronic
902702833 1:18184342-18184364 GAGTGGAGGCCCTGGGGAGGGGG - Intronic
904038960 1:27573398-27573420 TGGTAAAGACACTGGGGAGTAGG + Intronic
904681412 1:32232007-32232029 GGGGTAATACCCAGGGGAGAAGG + Intergenic
905231977 1:36520305-36520327 GGGGGAAGAGCCTTGGGAGAGGG - Intergenic
905486440 1:38300305-38300327 GGGTCAGGACCCTGGGGAAGAGG + Intergenic
905875249 1:41427988-41428010 GGGAGGAAACCCTGGGAAGAGGG - Intergenic
906109440 1:43313123-43313145 GGCTGGAGGCCCTGGGGAGATGG - Exonic
906460371 1:46031584-46031606 GGGTGAGGCCCCTGGGGAGCTGG + Exonic
906662529 1:47593223-47593245 CGCTGCAGACCCTGCGGAGACGG - Intergenic
907322352 1:53612566-53612588 GGGTCAAGATCCCAGGGAGATGG - Intronic
907519138 1:55011878-55011900 TGGTGAAGGTCCTGGGGAGAAGG + Intergenic
907523585 1:55040516-55040538 GGGTGGAGGGCCTGGAGAGAAGG + Intronic
908337981 1:63147024-63147046 AGGTGATGAGCCTGGAGAGATGG - Intergenic
908410056 1:63855050-63855072 GGGTGTGGAACCTGGGGATATGG + Intronic
908572296 1:65422262-65422284 GGGAGAATACCATGGGAAGACGG + Intronic
908743614 1:67354375-67354397 GAATAAAGTCCCTGGGGAGATGG + Intronic
908768653 1:67575883-67575905 GGGTGGAGACCCGGGGCAGAAGG - Intergenic
908799894 1:67868739-67868761 GGGTGAAGTCTGTGGGGACAGGG - Intergenic
908806326 1:67936932-67936954 GGTTGAAGAGCCTGGGGTGGGGG + Intergenic
908827945 1:68151685-68151707 GTGTGAAGGCCCTGGGGTGTGGG + Intronic
911305596 1:96228282-96228304 CTGTGAAGACTGTGGGGAGAGGG - Intergenic
911796972 1:102088197-102088219 GGGGGTAGGCCCTGGGGTGACGG + Intergenic
912579827 1:110710659-110710681 GGGTGAAGAGCAAGGTGAGATGG + Intergenic
912687720 1:111780058-111780080 GGTGGAAGACCCTGAGGAGTGGG - Intronic
913176252 1:116275777-116275799 GGGGAAACACCCTGGGAAGAAGG - Intergenic
915316123 1:155030063-155030085 GGGTGAGGGCCCTGAGGACAGGG - Exonic
915640879 1:157225081-157225103 AGGAAAAGACCCTGGGGAGAGGG - Intergenic
916562311 1:165943623-165943645 GGGTGAAGATTCTGGGAAGTTGG + Intergenic
916961951 1:169897349-169897371 AGGTGAGGACACTGGGAAGAGGG - Intergenic
918111142 1:181456385-181456407 GGGTGAAGAGCCTGAGGGTAAGG + Intronic
919640158 1:200038993-200039015 GGGGGAAGACGAGGGGGAGAAGG - Intronic
919924826 1:202186800-202186822 TACAGAAGACCCTGGGGAGAGGG + Intergenic
919961907 1:202479394-202479416 GGATCAAGATCCTGGAGAGAAGG + Intronic
921397921 1:214688644-214688666 GGCTGGAGACCCAGGAGAGATGG + Intergenic
922632639 1:227132134-227132156 AGAGGAAGACCGTGGGGAGAGGG - Intronic
922724938 1:227918319-227918341 GGAGGAGGACCCTGGGGAGGAGG - Intergenic
922724957 1:227918373-227918395 GGAGGAGGGCCCTGGGGAGAAGG - Intergenic
923084080 1:230688957-230688979 GGATGCAGAACCTGGGGATAAGG - Intronic
923243727 1:232110789-232110811 TGGTGACAACCCTGGGGGGAGGG + Intergenic
923338746 1:232990831-232990853 GGGAGACGACCCTGGGGAAGAGG - Intronic
1062761824 10:28289-28311 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1063455966 10:6182878-6182900 AAGTGAAGACCCTGGGGGGCTGG - Intronic
1063461768 10:6219364-6219386 GGGAGGATTCCCTGGGGAGATGG - Intronic
1063980115 10:11445898-11445920 GGATGTAGACTGTGGGGAGAAGG - Intergenic
1063983299 10:11473905-11473927 AGGGGCAGACCCTGAGGAGAAGG + Intronic
1064108829 10:12520918-12520940 GGAAGGAGACCGTGGGGAGAGGG + Intronic
1064949087 10:20827058-20827080 GGGTGGAGACACATGGGAGAGGG - Intronic
1066162202 10:32746179-32746201 GGATGTAGACCCTGGGCTGAAGG + Intronic
1067427282 10:46219863-46219885 GCAGGAAGACCCTGGGGAGAGGG + Intergenic
1067582715 10:47455748-47455770 GCAGGAAGACCCTGGGGGGAGGG + Intergenic
1067941371 10:50659769-50659791 GGGTGAAGAGCTTGGGGAACAGG - Intergenic
1068773960 10:60851781-60851803 GTGTGAGCACCCTGGGGAGGAGG + Intergenic
1069747900 10:70727402-70727424 GGCTGAAGGGCATGGGGAGATGG + Intronic
1069798836 10:71070037-71070059 GGAGGAAGCCCCTGAGGAGATGG + Intergenic
1070079092 10:73168162-73168184 AGGTGGGGACCCTGGGGAGGTGG + Exonic
1070129129 10:73644654-73644676 GGATGAAGACTGTGGGGAGAGGG + Intergenic
1070731953 10:78835357-78835379 GAAAGAAGACCATGGGGAGAGGG + Intergenic
1070862609 10:79684731-79684753 GGGTGAAGAGCTTGGGGAATAGG - Intergenic
1071593260 10:86896956-86896978 GCGTGAAGACACTGGGGAAAGGG - Intronic
1072835876 10:98711254-98711276 GGCTGTAGAGCCTGGTGAGAAGG + Intronic
1073040680 10:100602524-100602546 GGGTCAAGACCCTGAGGAAGCGG + Intergenic
1073064480 10:100750080-100750102 GGCTGAAGACCCAGGAGCGAGGG + Intronic
1073137929 10:101229929-101229951 GGGCGACGCGCCTGGGGAGAGGG + Intergenic
1073999896 10:109360312-109360334 GGGTTCAGACCTTGGGAAGATGG + Intergenic
1074875513 10:117610367-117610389 CTGGGAAGGCCCTGGGGAGAAGG - Intergenic
1075124343 10:119687632-119687654 GGGTCAAGGTCCTGGAGAGAAGG + Intergenic
1075642693 10:124076061-124076083 GGATGAAAAGCCAGGGGAGATGG + Intronic
1075842621 10:125517763-125517785 AGGGGGAGACCGTGGGGAGAGGG - Intergenic
1075969866 10:126643301-126643323 TGGGGAAGACCCTGTGGAGTGGG - Intronic
1076024932 10:127103435-127103457 GGTTGAAGAGCGTGGGGTGAAGG + Intronic
1076377394 10:130000926-130000948 GGGTGGAGAGGCTGAGGAGAGGG - Intergenic
1076422409 10:130340684-130340706 GGGAGAAGGCCCTGGGAGGATGG - Intergenic
1076723326 10:132402176-132402198 GGCTGAAGATCCTGGGGCAAGGG + Intronic
1076846804 10:133073196-133073218 TGGTGAGGACCCTGGGCAGCAGG + Intronic
1076899234 10:133328932-133328954 AGGTAAAGACCCTGGGGACCAGG - Exonic
1078422128 11:11221159-11221181 GGGAGGAGAGTCTGGGGAGAGGG - Intergenic
1079325667 11:19489207-19489229 AGGTGTAGACCCTTGGGAAAGGG - Intronic
1080765780 11:35295626-35295648 GGCTGGAGAGCCTGGGGAGAGGG + Intronic
1081990892 11:47336971-47336993 AGGTGAAAACCCTGGGTTGAAGG + Intronic
1082888225 11:58110864-58110886 GGATGAAGTCCCTGGAGAGTGGG + Intronic
1083273812 11:61585948-61585970 GTGAGAATACCCTGGGGAGATGG + Intergenic
1083479845 11:62936773-62936795 AGGTGAAGGACCTGGAGAGAAGG - Intronic
1083596588 11:63920665-63920687 GGGAGGTGACCCTGGGGAAATGG + Intergenic
1083782158 11:64924299-64924321 GGGTGAGGTTCCTGGGGGGATGG + Intronic
1084007484 11:66331079-66331101 GGGTGACCACCCAGGGGTGAGGG - Intronic
1084157509 11:67322366-67322388 GGAGGATGCCCCTGGGGAGAGGG + Intronic
1084315697 11:68344039-68344061 GGGTGAAGTCCCTCGGGCGGGGG - Intronic
1084416515 11:69035805-69035827 GGGTGAAGCCCCGGGAGAGGGGG - Intergenic
1084482908 11:69432406-69432428 GGGAGAAGGTGCTGGGGAGAGGG - Intergenic
1084604057 11:70162301-70162323 CAGTGAGGACCCTGGGCAGAGGG + Intronic
1084678228 11:70649290-70649312 ATCTGAAGATCCTGGGGAGAGGG + Intronic
1084955950 11:72691691-72691713 GGCTGAAGACACTGGGGATGGGG + Intronic
1085190409 11:74615695-74615717 GGTTGAAAATCCTGGGGAGGTGG + Intronic
1085923191 11:80983410-80983432 TGGTGATGACACTGAGGAGAGGG - Intergenic
1086777894 11:90862869-90862891 GGGTGGAGAGTCTGGGGGGAGGG + Intergenic
1087520922 11:99234271-99234293 GGATGAAGACAATGGGAAGAAGG + Intronic
1087665979 11:101048111-101048133 GGGTGAAGCCACTGGCTAGAAGG + Intronic
1088037442 11:105334479-105334501 GGATGGAGCCCCTGGGGAGAGGG + Intergenic
1088896505 11:114082750-114082772 GGGAGAGGGGCCTGGGGAGAGGG + Intronic
1088906028 11:114156145-114156167 GGCTGCAGTCCCTGGGCAGAGGG + Intronic
1088953895 11:114598836-114598858 AGGTGGAGACAATGGGGAGAAGG - Intergenic
1089346579 11:117795421-117795443 GCAGGAAGAACCTGGGGAGAGGG + Intronic
1089347536 11:117800034-117800056 GGCGGAAGAGCCTGGAGAGATGG + Intronic
1089583914 11:119498061-119498083 GGGAGGAGGCCCTGGGGAGGGGG - Intergenic
1089590896 11:119540176-119540198 GTGTGAACCCCCTGAGGAGAAGG - Intergenic
1090329403 11:125918925-125918947 GTGTGAGGAAACTGGGGAGATGG - Intronic
1091547942 12:1516863-1516885 GGCCGAAGACCTGGGGGAGAAGG - Intergenic
1091733036 12:2895249-2895271 GGGAGAACTGCCTGGGGAGAGGG - Intronic
1092369039 12:7901305-7901327 AGGTGAAGACCTAGGGCAGAAGG + Intergenic
1093068434 12:14683642-14683664 AGGTGAACAAGCTGGGGAGAAGG - Intronic
1094811562 12:34143232-34143254 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1095178253 12:39117814-39117836 GGGGGAAGAATCAGGGGAGAAGG + Intergenic
1096187083 12:49588374-49588396 GGGTGACCAGCCTGGGGAGGTGG - Intronic
1096411445 12:51379635-51379657 GGCTGAAGTCCCTGGTGAGCCGG - Exonic
1096649350 12:53054258-53054280 GGCTGAAGCTCCTGGGGAGGAGG - Exonic
1097046850 12:56193366-56193388 GGGTGAAGGAATTGGGGAGATGG - Intergenic
1100995448 12:100295750-100295772 CGGGGGAGACCGTGGGGAGACGG + Intronic
1101597547 12:106180363-106180385 GGGGGAAGACTGTGGGAAGAGGG + Intergenic
1101714911 12:107302223-107302245 CAGGGAAGTCCCTGGGGAGAAGG - Intergenic
1102352942 12:112208074-112208096 GGGTGAAGACCTCAGGGTGAGGG - Intronic
1102684079 12:114710582-114710604 GGGGGAAAACCCTTAGGAGATGG + Intergenic
1103479480 12:121241755-121241777 GGGTAAGGTCCCTGGGGAGGGGG + Intronic
1104486005 12:129151629-129151651 GGATGGAGTCCTTGGGGAGATGG - Intronic
1105069686 12:133227014-133227036 AGCTGAAGACCCTGGTGCGAGGG - Exonic
1105977870 13:25489251-25489273 GGAAGAGGAGCCTGGGGAGATGG - Intronic
1106876155 13:34076155-34076177 GGGTGAAGATGCTGGGGGGTGGG + Intergenic
1107812242 13:44211702-44211724 GCGGGAAGATCCTGGGCAGAGGG + Intergenic
1108676153 13:52739390-52739412 GGGTGCAGGTCCTGGGGCGAAGG - Intronic
1108708346 13:53010268-53010290 AGGAGAAGAGACTGGGGAGATGG + Intergenic
1110452927 13:75657083-75657105 GGATGAAGGCCGTGGGAAGATGG + Intronic
1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG + Intronic
1112491187 13:99865738-99865760 GGATGGAGAACTTGGGGAGACGG - Intronic
1113434268 13:110277534-110277556 GAGTGCAGACCCTGGGAAGCTGG - Intronic
1114165002 14:20212060-20212082 AGAGGGAGACCCTGGGGAGAGGG - Intergenic
1114450040 14:22819481-22819503 GGCTGAAGTCTCTGGGCAGAAGG + Intronic
1114675292 14:24436254-24436276 GGGTGAAAACTCTGGGAAGGAGG + Intronic
1118037747 14:61886481-61886503 TGGTGAAGACGCTGTGGACACGG - Intergenic
1118114667 14:62761886-62761908 GGATGCAGACCCTGGGGTGAAGG + Intronic
1118423380 14:65633013-65633035 AGAGGGAGACCCTGGGGAGACGG - Intronic
1118505031 14:66402051-66402073 GTGGGAAGAGCCTGGGGACAGGG - Intergenic
1118760815 14:68879367-68879389 GGGGGAAGCCCCTGGGGAAGCGG - Intronic
1119195340 14:72713453-72713475 GACTGCAGACCCTGGCGAGATGG + Intronic
1119559297 14:75577983-75578005 GGGCGAAGACCCTAGGGTGCGGG - Intergenic
1120184867 14:81384082-81384104 GAGTGAAGACCTGGGGGAAATGG - Intronic
1120691274 14:87596048-87596070 TGGTGAAGACACTGGGGTAATGG + Intergenic
1121050568 14:90816651-90816673 GGGTGAAGACCGAGGGGAAGTGG + Intergenic
1121643205 14:95500203-95500225 AGGTGAAGGTTCTGGGGAGAAGG - Intergenic
1121732275 14:96194972-96194994 GGGTGATGGCCGTGGGGAGGGGG + Intergenic
1122536252 14:102465407-102465429 GTGTGTAGACCCTGGGGGCATGG - Intronic
1122544177 14:102513134-102513156 GTGTGAGGACGCTGGGGAGTGGG + Intergenic
1122894283 14:104748307-104748329 GGGGTAAGCTCCTGGGGAGAGGG + Intergenic
1123068923 14:105631662-105631684 GGGAGAACACCCTGTGAAGATGG - Intergenic
1123138923 14:106056155-106056177 GGGTGGGAACCCTGAGGAGACGG + Intergenic
1124866129 15:33493134-33493156 GGGTGAAGATTGAGGGGAGAGGG - Intronic
1125891583 15:43270708-43270730 GGGTGAGGGTGCTGGGGAGAGGG + Intergenic
1126383870 15:48074326-48074348 GGGTGAAGGCACTGTGGAAAGGG - Intergenic
1127588229 15:60397871-60397893 GTGTGGAGACGCTGGGAAGAAGG - Exonic
1129181628 15:73881632-73881654 GGGTGCAGACCCTGGGGTGGGGG - Exonic
1129230858 15:74196517-74196539 GGGTGTGGACCCGGGGCAGAGGG + Intronic
1129232706 15:74205677-74205699 GGCTGCAGCCCCTGGGCAGATGG - Intronic
1129321596 15:74778015-74778037 GGCTGGAGCACCTGGGGAGATGG - Intergenic
1129788522 15:78324915-78324937 GCGTGACTACCCTGGGAAGATGG + Intergenic
1130032480 15:80328440-80328462 GGGGGAAGAGCCCGAGGAGAAGG + Intergenic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1131035802 15:89221466-89221488 GGGTGAGGACTCAGGGGAGCAGG - Intronic
1131184717 15:90264897-90264919 GGGTGCAGACGCAGGGCAGAGGG - Exonic
1131870237 15:96756738-96756760 AGGTGGGGACCCTGGGGAGGTGG + Intergenic
1132689705 16:1177017-1177039 GGGGGAAGCTCCTGGGGGGAGGG - Intronic
1133156953 16:3881788-3881810 AGGTAAAGACCGTGGGTAGAGGG - Intergenic
1133225393 16:4338214-4338236 GGGAGGAGACCCTGGGGTGCAGG - Exonic
1133732754 16:8590420-8590442 GCGGGAAGACCCTGGAGAGCAGG - Intergenic
1135736199 16:24933704-24933726 GTGTGAAGAGGATGGGGAGAGGG + Intronic
1136315964 16:29454917-29454939 GGGCGAGGGCCCTGGTGAGAGGG + Exonic
1136430541 16:30194259-30194281 GGGCGAGGGCCCTGGTGAGAGGG + Exonic
1137394399 16:48106621-48106643 GGGTGGTGGCACTGGGGAGATGG - Intronic
1137718599 16:50613815-50613837 GGGGGAAGCCCCGGGAGAGAAGG - Intronic
1138465566 16:57187049-57187071 GGGTAAGGACCTTGGGGAGAGGG + Exonic
1140926750 16:79590587-79590609 GGGTGCAGACCCTGGTGCTAAGG + Intronic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1143000509 17:3792005-3792027 GGAGGAGGAACCTGGGGAGATGG + Intronic
1143593203 17:7898359-7898381 GGGTAAAGAGCCTGGGAAAAAGG + Intronic
1144637766 17:16921196-16921218 GGCTGTGGACCATGGGGAGAGGG - Intergenic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1144799176 17:17913238-17913260 CGGGGGAGACCGTGGGGAGACGG + Intronic
1145828480 17:27895731-27895753 GGGTGAGGGCCATGGGGTGATGG + Intergenic
1146034204 17:29391164-29391186 GGGTGAAGAAGCTGGTGAGCTGG + Intronic
1146652174 17:34613674-34613696 GGGTGCAGAAGCTAGGGAGAAGG - Intronic
1146655291 17:34631385-34631407 GGGTGAGGGCCCTTGGGAGCAGG - Intronic
1146677605 17:34784308-34784330 GGGAGATAACCCTGGGAAGATGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147278253 17:39336980-39337002 AGAGGAAGACCGTGGGGAGAGGG - Intronic
1147702631 17:42405457-42405479 TGGTGACGATCCTGGAGAGAGGG + Intronic
1148733540 17:49851823-49851845 TGGTGGGGACCCTGGGGACAGGG + Intergenic
1148777896 17:50105802-50105824 GGGTGAAGACACCGTGGAGAGGG + Intronic
1149448097 17:56729405-56729427 GGGTGAAGAGCCTGCAGGGAAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149982132 17:61319144-61319166 GGGTGTAGGCCCGGGGTAGAGGG - Intronic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150210102 17:63437188-63437210 TGGTTCAGAGCCTGGGGAGATGG - Intronic
1150537342 17:66056714-66056736 GGTTGAAGAGCCTGGGGTGTGGG + Intronic
1150653202 17:67023142-67023164 AGGAGAAGACACAGGGGAGAAGG - Intronic
1151343576 17:73487393-73487415 GGCTGAAGACACTGGCAAGAGGG + Intronic
1151388544 17:73770410-73770432 GGGAGAAGGCAGTGGGGAGATGG + Intergenic
1151410211 17:73920211-73920233 GGGAGAAGGCCATGTGGAGATGG + Intergenic
1151699982 17:75737780-75737802 GGATGGGGACCCTGGGGAGGTGG - Intronic
1151700003 17:75737833-75737855 GGTTGAGGACACTGGGGAGGTGG - Intronic
1152132192 17:78484418-78484440 GAGAGATGCCCCTGGGGAGATGG - Intronic
1152181215 17:78822918-78822940 GGCTGGAGAGCCTGGGGAGAGGG - Intronic
1152386762 17:79979429-79979451 GTGTGGAAACCCAGGGGAGATGG + Intronic
1152702514 17:81826041-81826063 GGGAGAAGAGCCACGGGAGAGGG - Exonic
1152791708 17:82283634-82283656 GGGTGGACACCCTGGGGAGGAGG - Intergenic
1152954731 18:28619-28641 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1154145307 18:11861686-11861708 GGGTGATGACCCTTCCGAGAGGG - Intronic
1156352327 18:36311867-36311889 GGGTGAAGACACAGTGGAAAAGG - Intronic
1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG + Intronic
1159918050 18:74203437-74203459 GGGAGAAGGCCCTGTGAAGATGG - Intergenic
1160675463 19:388909-388931 GGGTGAAGATCCTGGGCCCAAGG - Intergenic
1160972545 19:1775931-1775953 GGCTGAGGTCCCTGGGGAGGGGG - Exonic
1161204054 19:3031234-3031256 GGGAGAGGACCCTTGGGGGAGGG + Intronic
1161297142 19:3525899-3525921 GGGCGAGGACACTGGGGAGCTGG - Exonic
1161299780 19:3537123-3537145 GGGTGAAGGCCGTGGTGGGAGGG + Intronic
1161398770 19:4058616-4058638 GGGCAAGGCCCCTGGGGAGAGGG + Intronic
1161977765 19:7615718-7615740 GGGTGAGGACCCTTGGGGGACGG + Exonic
1163493157 19:17629155-17629177 GTGTCAGGGCCCTGGGGAGAAGG + Intronic
1163635334 19:18434706-18434728 GGGTGATGACCATGGGCAGAGGG + Exonic
1163912950 19:20213891-20213913 AGAGGGAGACCCTGGGGAGAGGG - Intergenic
1164441508 19:28283466-28283488 GGGAGAAGACTCTGGGGAGAGGG - Intergenic
1164441643 19:28284262-28284284 GGGAGAAGACTTTGGGAAGAAGG - Intergenic
1164590969 19:29506717-29506739 GGGTGAAGTCAGTGGGAAGAGGG - Intergenic
1164667503 19:30051305-30051327 GAGTGAAGACCCTGGGGTCTCGG - Intergenic
1165846189 19:38819235-38819257 GAGTAAAGACCCAGAGGAGAGGG + Intronic
1168172020 19:54595558-54595580 TGGTGAGGCCCCGGGGGAGAGGG + Intronic
1168186724 19:54704983-54705005 GTGTGAAGTCCCTGGGAAGATGG + Intergenic
1168290059 19:55353220-55353242 GGGGAAGGAGCCTGGGGAGATGG + Intronic
1168707785 19:58479754-58479776 GGGTGCAGGCCCCAGGGAGAGGG - Intronic
924970794 2:126211-126233 GGAAGGAGACCGTGGGGAGAGGG - Intergenic
925098607 2:1227551-1227573 GGGTGGATACCGTGGGGAAACGG - Intronic
926012092 2:9416529-9416551 GGCTGAAGACCCCTGGGAGTGGG - Intronic
926027142 2:9555488-9555510 CGGTAAAGACCCAGGGGAGTTGG - Exonic
926558259 2:14385980-14386002 AGGTGCAGACCCTGAGGATATGG + Intergenic
928094248 2:28394120-28394142 GGGGGCAGACACTGGGGAGGGGG - Intronic
928687339 2:33762167-33762189 GGAGGGAGACCCTGGGGAGAGGG + Intergenic
929564668 2:42976854-42976876 GAGTGCAGGACCTGGGGAGAAGG - Intergenic
930370152 2:50491530-50491552 GGGTGATGATCCTGGTAAGAAGG + Intronic
931283892 2:60816893-60816915 GTGCAAAGACCCTGGGAAGAAGG - Intergenic
931758490 2:65395372-65395394 TGGTGAGAACCCTGGAGAGAAGG - Intronic
931882655 2:66582885-66582907 GGAGGGAGACCCTGAGGAGAGGG - Intergenic
932450178 2:71804759-71804781 GAGAGATGACCCTGGGAAGAAGG + Intergenic
933319708 2:80757987-80758009 GGGTGCAGACCTTGGGCTGAAGG - Intergenic
933759272 2:85662991-85663013 GGATCAGGACCCTGGAGAGAAGG + Intronic
935350879 2:102151172-102151194 TGGGGATGACCCTGAGGAGAGGG - Intronic
935805609 2:106744597-106744619 GTGTGAAGACAACGGGGAGAGGG + Intergenic
935810723 2:106794491-106794513 GAGTGAGGATTCTGGGGAGATGG + Intergenic
936091811 2:109506454-109506476 TTGTGAGGACCCTGGAGAGAGGG + Intergenic
937307516 2:120881484-120881506 TGGGGAAGACAGTGGGGAGAGGG + Intronic
937619649 2:123970975-123970997 GGGGGAAGTCCCTGGAGACATGG - Intergenic
937911806 2:127079240-127079262 GTGAGAAGACCCTTGGGAAAAGG + Intronic
938178618 2:129160000-129160022 AGGTGAAGCCCATGGGAAGAGGG + Intergenic
938533626 2:132220370-132220392 GGAAGGAGACCGTGGGGAGAGGG - Intronic
938712129 2:133984041-133984063 GGGTGAGTTCCATGGGGAGAAGG - Intergenic
938720473 2:134063407-134063429 AGAGGGAGACCCTGGGGAGAGGG - Intergenic
939811067 2:146832778-146832800 GAGTGAAGAGTCGGGGGAGATGG + Intergenic
940762324 2:157751378-157751400 GGGAAAAGACCACGGGGAGATGG + Intronic
942621207 2:177846021-177846043 AGGGGGAGACCGTGGGGAGAGGG + Intronic
943740191 2:191399255-191399277 GGAAGGAGACCGTGGGGAGAGGG + Intronic
945430207 2:209755100-209755122 GGGTGCAGACCCTGGGGAAGGGG + Intergenic
945935423 2:215898632-215898654 GGATGGAGACCCTGAGGAGGTGG - Intergenic
946241190 2:218357050-218357072 GATGGCAGACCCTGGGGAGAAGG - Intronic
946352113 2:219162010-219162032 GCCTGAAGACCCTGGGGATGAGG - Exonic
946369540 2:219272215-219272237 GGGGGAAAACCATGGGGGGAGGG + Intronic
947475762 2:230446485-230446507 TGGGGAATTCCCTGGGGAGAAGG - Intronic
947619205 2:231577840-231577862 GGGTGAAGAGCCTGGACAGATGG + Intergenic
948481870 2:238255224-238255246 GGGTGCATCTCCTGGGGAGAAGG + Intronic
948740455 2:240042758-240042780 GGGTGAAGAGCCGTGGGTGAAGG + Exonic
948898810 2:240945584-240945606 GAGTGAAGATCTTGGAGAGAAGG - Intronic
949025379 2:241765295-241765317 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025397 2:241765345-241765367 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025415 2:241765395-241765417 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025433 2:241765445-241765467 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025650 2:241766045-241766067 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025666 2:241766095-241766117 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025775 2:241766395-241766417 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025793 2:241766445-241766467 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025901 2:241766745-241766767 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025919 2:241766795-241766817 GGGGGGAGAACTTGGGGAGATGG + Intronic
949025937 2:241766845-241766867 GGGGGGAGAACTTGGGGAGATGG + Intronic
1169885796 20:10395780-10395802 AGAGGGAGACCCTGGGGAGAGGG + Intergenic
1171122933 20:22581759-22581781 GGGTCGAGACTTTGGGGAGACGG - Exonic
1171774789 20:29355190-29355212 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1171901547 20:30863157-30863179 GGATGAAGTCCCGAGGGAGAAGG - Intergenic
1172476725 20:35244208-35244230 GGGAAAAGAGCCTGGGGAAATGG - Intronic
1172802929 20:37590978-37591000 GGGTGGTGCCACTGGGGAGATGG + Intergenic
1172821154 20:37735612-37735634 AGCTGTAGACCCTGGGGAGGAGG + Intronic
1173844497 20:46179276-46179298 GACTGAAGACCGCGGGGAGAAGG - Intronic
1174044219 20:47721992-47722014 GGGTCACCACACTGGGGAGATGG + Intronic
1175019245 20:55826793-55826815 GCGTGAAGACCCTGTGCTGAGGG + Intergenic
1175369200 20:58475846-58475868 GGATGAAGGCCATGGGAAGATGG - Intronic
1175864273 20:62166249-62166271 GCCTGCAGTCCCTGGGGAGAGGG + Intronic
1175946539 20:62561530-62561552 GGGTGAGGACACAGGGGAGCAGG - Intronic
1175954967 20:62604561-62604583 GGCTGCAGACCTTGGGGAGGAGG - Intergenic
1176230617 20:64030923-64030945 GGGAGGTGACCCTGAGGAGAGGG + Intronic
1176264119 20:64199732-64199754 GGGTGAGCGCCCTGGGGAAACGG + Intronic
1177114181 21:17065682-17065704 CCCTGAAGTCCCTGGGGAGAAGG - Intergenic
1177547587 21:22578929-22578951 GAGGGAAGAACCAGGGGAGAAGG + Intergenic
1178817282 21:35943200-35943222 GGGTGCAGACCCAGGAGAGGTGG - Intronic
1179179112 21:39030424-39030446 GGTTGAAGAGGCTGGGGACAGGG + Intergenic
1180155998 21:45977677-45977699 GGGTGGAGCCCCATGGGAGAAGG + Intergenic
1180320267 22:11313428-11313450 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1180334916 22:11569105-11569127 GGATGAAGTCCCGAGGGAGAGGG - Intergenic
1180920288 22:19518210-19518232 GGGTGGAGAGCCAGGGGTGAGGG + Intronic
1181429109 22:22866966-22866988 GGGGGAAGACATTGGAGAGACGG + Intronic
1181447163 22:22986214-22986236 GTATGAAGAAGCTGGGGAGATGG - Intergenic
1181518585 22:23432551-23432573 GGGTGAGGACAGTGGGGAAAGGG + Intergenic
1182071872 22:27469520-27469542 AGGTGGAGAAGCTGGGGAGAAGG - Intergenic
1182662876 22:31937347-31937369 GGGTGATGACCTTGAGAAGATGG + Intronic
1183111924 22:35656486-35656508 GGGTGTAGTCCCCAGGGAGAGGG + Intronic
1183248836 22:36713911-36713933 AGGTGAGGACCCAGGGAAGAGGG - Intergenic
1183386157 22:37515954-37515976 GGCGGTAGGCCCTGGGGAGATGG - Exonic
1183394241 22:37562162-37562184 GGGTGAAGACGATGGGGAATGGG - Intronic
1183585964 22:38753085-38753107 GGGAGAAGTCTCTAGGGAGAAGG - Intronic
1184046566 22:41976179-41976201 AGGTGGGCACCCTGGGGAGAGGG - Intergenic
1184109241 22:42385368-42385390 GGGGGAAGAGGCTGGGGAGGTGG - Intronic
1184299008 22:43543929-43543951 GGGTGAAGACACAGAGGTGAAGG - Intronic
1184428010 22:44424420-44424442 AGGGGAAGACCCTGGGGACAGGG + Intergenic
1184492181 22:44816041-44816063 GGATGAAGCCTCTGGGGACAGGG + Intronic
949398639 3:3642039-3642061 TGGTTAAGACCCTGGGAAGGAGG + Intergenic
951957745 3:28275752-28275774 GGATGGAGACCCTGGGGGCAAGG - Intronic
952252854 3:31671421-31671443 GTGTGAAGAGGCTGGGAAGAGGG + Intronic
952548649 3:34450481-34450503 GGATGGAGAGCCTGGGGAGTAGG - Intergenic
953854930 3:46493887-46493909 CGGGGGAGACCGTGGGGAGACGG - Intergenic
954599599 3:51857935-51857957 CGGGGGAGACCGTGGGGAGATGG - Intergenic
955015373 3:55064461-55064483 CTGGGAACACCCTGGGGAGATGG + Intronic
955064940 3:55526082-55526104 GGGAGAAGGCCATGGGGTGATGG + Intronic
955153550 3:56392997-56393019 ATGTGAAGACCCTAGGGAGGAGG - Intronic
955236596 3:57144815-57144837 GGTTGAAGAGAGTGGGGAGAAGG - Intronic
956699060 3:71942713-71942735 GGGTGAAGACTGAGGGGATATGG + Intergenic
956780809 3:72601651-72601673 GGATGGAGGTCCTGGGGAGAAGG + Intergenic
958178976 3:90033124-90033146 CCGTGTAGACACTGGGGAGAAGG - Intergenic
958882269 3:99686434-99686456 GAGGAAAGACCCTGGGGAGAGGG + Intronic
960951070 3:122998733-122998755 GAGTGGAGCCCCTGGGAAGAGGG - Intronic
961474721 3:127139681-127139703 AGGACAAGACCCTGGGGCGATGG + Intergenic
961683685 3:128615735-128615757 GGCTGAAGATCCAGGAGAGAAGG - Intergenic
962747334 3:138406770-138406792 GGGTGCAGATGCTGGGGAGGGGG - Intergenic
963854435 3:150239115-150239137 AGCTGGAGACCTTGGGGAGATGG + Intergenic
964188924 3:153980007-153980029 GGGTGAACACCACAGGGAGAAGG + Intergenic
964536938 3:157732433-157732455 GGGTCAAGATTCTGGAGAGATGG + Intergenic
965160787 3:165130117-165130139 GTGTGGAGAGCATGGGGAGAGGG - Intergenic
965318590 3:167223192-167223214 GGGTGAGGACTCTGAGGGGAAGG - Intergenic
966985480 3:185175965-185175987 GAGTGAAGAGCCTGGGGTGGGGG - Intergenic
967217106 3:187220145-187220167 GGGTGATGACTGTGGGAAGAAGG - Intronic
967540971 3:190667419-190667441 TGGTGATGAGCCTGGGAAGAAGG - Intergenic
968253887 3:197247860-197247882 GGGTTAAGCCTCTAGGGAGAGGG - Intronic
968358991 3:198133520-198133542 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
968411483 4:394986-395008 AGAGGAAGACCGTGGGGAGAGGG - Intergenic
968491342 4:892164-892186 GGGTGTGGAGCGTGGGGAGAAGG - Intronic
969476686 4:7426143-7426165 GGCTGTAGACCCAGAGGAGAAGG + Intronic
970391475 4:15616622-15616644 GGGGAAAGACCATAGGGAGAAGG - Intronic
973022176 4:45217445-45217467 TGGTGAAGAGCCTGGTGGGATGG + Intergenic
974801877 4:66828534-66828556 GGGAAAAGACCATGGGGAGAAGG - Intergenic
975489873 4:74976456-74976478 GGATGGAGACCCTGGGAGGAGGG + Intronic
977097377 4:92763385-92763407 GGATGCAGAACCTGGGGATATGG - Intronic
978327930 4:107579711-107579733 GGATGAAGCCCCTGTGGAGAGGG + Intergenic
981507010 4:145513229-145513251 GGGCCAAGATCCTGGAGAGAGGG - Intronic
982164681 4:152604040-152604062 GAGAGAAGACCCTGTGGAGATGG + Intergenic
983581429 4:169313322-169313344 GGGAGAAGACCGTGTGAAGATGG + Intergenic
984711360 4:182888015-182888037 GGAGTAAGACCCTGGGGAGAGGG - Intergenic
985009270 4:185565975-185565997 GGGGGAAGGCCTGGGGGAGAAGG + Intergenic
985980581 5:3459190-3459212 GGGTGGTCACCCTTGGGAGAGGG + Intergenic
986452964 5:7884566-7884588 GGGTGGAGAACCTGAGGATATGG + Intronic
988544159 5:32141593-32141615 GGAGGGAGACCGTGGGGAGAGGG - Intronic
988800099 5:34688648-34688670 GGGAGGAGAGCCTGGGGAGGAGG + Intronic
991171490 5:63631179-63631201 GGATGAAGATTCAGGGGAGATGG + Intergenic
996790808 5:127291001-127291023 GGGTGAAGACCGGGGAGAAAAGG + Exonic
997058387 5:130471582-130471604 TTTTGAAGACCCTGGGGGGAAGG - Intergenic
997442511 5:133918835-133918857 GGGGGAATCCCCTGTGGAGATGG - Intergenic
998136383 5:139676517-139676539 TGGGGAGGACACTGGGGAGAAGG - Intronic
999205857 5:149847425-149847447 GGGTGAAGAGGCAGGGAAGAGGG - Intronic
999247705 5:150163970-150163992 GAGTCAAGGCCCTGGGGAGTGGG - Intergenic
999907103 5:156153710-156153732 GGGGGAAGACTCTAGGGTGATGG + Intronic
1000223981 5:159240393-159240415 GGGAGAAGACCATGTGAAGATGG - Intergenic
1003121390 6:3321706-3321728 GGGTGCAGAGCCTGGGGTGAGGG + Intronic
1004645863 6:17560198-17560220 GAGTGAAGGCTCTGGGGAGGTGG - Intergenic
1005905821 6:30260805-30260827 GGATGAAGTCCCTGAGGAAATGG + Intergenic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1006298493 6:33180667-33180689 AGTTGGAGACCCTGGAGAGAGGG - Exonic
1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG + Intergenic
1006623113 6:35380969-35380991 AGGTAGAGACCCTGGAGAGATGG - Intronic
1007615939 6:43179836-43179858 GGGGGAAGACAAGGGGGAGAAGG - Exonic
1007618837 6:43199254-43199276 GGGTTATGACCCTGGTGAGGGGG - Exonic
1008909009 6:56713194-56713216 GTCTGAAGACCCTGGGCAGCTGG + Intronic
1009632349 6:66214889-66214911 GGGTGGAGACACTGGGAAGATGG + Intergenic
1009792233 6:68418899-68418921 GGGGGAAGAACCTGGTGGGAAGG + Intergenic
1012724590 6:102793717-102793739 TGGTTAAGACCATTGGGAGAAGG + Intergenic
1013131955 6:107241764-107241786 TGGTGAAGATCCTGGGTAGTAGG - Intronic
1013169275 6:107621602-107621624 GGCTCATGAACCTGGGGAGAAGG - Intronic
1013263239 6:108468040-108468062 GGGTGCTGACACTTGGGAGAAGG - Intronic
1013352655 6:109319374-109319396 AGGAGAAGACCCTGAGGAAAAGG - Intergenic
1014104236 6:117545126-117545148 GTGTTTAGACCCTGGGGAGGTGG - Intronic
1016684338 6:146864353-146864375 ACGGGAAGAACCTGGGGAGATGG - Intergenic
1017537250 6:155361971-155361993 GGGTTAAGGGCATGGGGAGATGG + Intergenic
1018089127 6:160330304-160330326 AGGAGAAGGCCATGGGGAGATGG + Intergenic
1018541919 6:164890365-164890387 GGTTGAAGACCCTGAGGCTAAGG - Intergenic
1018576969 6:165268993-165269015 GGCAAAAGACCTTGGGGAGAAGG + Intergenic
1018860975 6:167710291-167710313 TAGTGAAGGCCCTGGGGAGACGG + Intergenic
1019410675 7:905261-905283 GGGAGAAGACACGGGGGACACGG + Intronic
1019501203 7:1365535-1365557 AGCTGAAGACCCTGGTGAGCAGG - Intergenic
1019522866 7:1468483-1468505 GGGTGTTGCACCTGGGGAGAAGG + Intergenic
1019599978 7:1876393-1876415 GGGTGAGGACGGTGGGGAAAGGG - Intronic
1019975948 7:4581688-4581710 AGCTGGAGACCCTGGGGTGATGG + Intergenic
1020619132 7:10497015-10497037 GGAGGAAGCCCCTGGCGAGAGGG + Intergenic
1021730043 7:23587049-23587071 GGAGGAAGACTTTGGGGAGAGGG - Intergenic
1021735145 7:23635889-23635911 GGAAGGAGACCGTGGGGAGAGGG - Intronic
1021740198 7:23679225-23679247 GGAGGAAGACTTTGGGGAGAGGG + Intergenic
1022502066 7:30887868-30887890 GGGTTAAGGCCCAGGGGTGAGGG + Intronic
1024002912 7:45202715-45202737 GAGTGAAGGCTCTGGGGAGGAGG - Intergenic
1025778173 7:64576867-64576889 AGAGGAAGACCGTGGGGAGAGGG - Intergenic
1026015566 7:66668528-66668550 TGGAGAAGACCCTCTGGAGAGGG + Intronic
1027050557 7:75018891-75018913 GGGTGCAGGGCCTGGGAAGAGGG - Intronic
1029170783 7:98627807-98627829 GGGTTAAGACCCTGAGCAGGGGG - Intronic
1029622810 7:101700450-101700472 GGGTGGGGGGCCTGGGGAGAAGG + Intergenic
1029642335 7:101828987-101829009 GGGTCGAGCCCCTGGGGAAAAGG + Intronic
1029663401 7:101978683-101978705 GGGTGAAGACCGGGGCTAGAGGG - Intronic
1030155382 7:106449328-106449350 GGGAGAAGAAGCTGGGTAGAAGG - Intergenic
1031890626 7:127289525-127289547 GGGAGAAGACTCTGGAGAGTGGG - Intergenic
1032127738 7:129206801-129206823 GGGCCAAGGCCCTGGAGAGAGGG - Intronic
1033653908 7:143361319-143361341 TGGAGAAGAGCCTGAGGAGAAGG + Intronic
1034104313 7:148477329-148477351 GGGTGAGGATAATGGGGAGAAGG + Intergenic
1035571109 8:673391-673413 GGGTGCAGACTCCGGGGAGGAGG - Exonic
1037626869 8:20615756-20615778 AGGTTAAGACCCTGGGTAGGAGG - Intergenic
1039104023 8:33970898-33970920 GGGTGGGGTCCCTGGAGAGAGGG - Intergenic
1039213194 8:35238326-35238348 GGAGGAAGACCCTTGGGACAAGG + Intronic
1039476043 8:37839924-37839946 GGGAGAGAACCCTGGGGTGAAGG + Intronic
1039785618 8:40832070-40832092 GGGTGAAGGCCGTGGGCACAGGG - Intronic
1042091269 8:65162383-65162405 GGGTGAAGACCATGTAGGGATGG - Intergenic
1043045301 8:75315410-75315432 GTGTGGGGACCCTGGGGAGAGGG + Intergenic
1045340838 8:101253010-101253032 GGGTAGAGACACTGGGGAGGAGG - Intergenic
1047170104 8:122484439-122484461 GGGTGAAGATTCTAAGGAGAGGG - Intergenic
1047218066 8:122895101-122895123 TGGAGATGACCCTGGGGAGAGGG - Intronic
1048392638 8:133982411-133982433 AGGTGCAGGCTCTGGGGAGAAGG - Intergenic
1048909959 8:139125802-139125824 GGTTGATTACCCTGGGGAAATGG + Intergenic
1049749086 8:144275095-144275117 GGGGGAAGAACCTGGGGGGAGGG + Intronic
1050094646 9:2051437-2051459 GGGTGGGAACCCCGGGGAGATGG - Intronic
1050690386 9:8221119-8221141 GGTTGGAGACCCTGGGTTGATGG + Intergenic
1053174264 9:35910766-35910788 GGGAGAAGGCCCTGGGAGGAGGG - Intergenic
1053471067 9:38346504-38346526 GGGTGGAGATGCTGGGGAAATGG - Intergenic
1056211486 9:84368887-84368909 GGGTGGAGGAACTGGGGAGAGGG + Intergenic
1056211833 9:84372015-84372037 GGGTGGAGGAGCTGGGGAGAGGG + Intergenic
1056763784 9:89432342-89432364 GGGACAGGACCCTGGGGAGTTGG + Intronic
1056950417 9:91036800-91036822 GGGTGAAGAGTCCGTGGAGAGGG + Intergenic
1057080770 9:92172933-92172955 GGGTGAAGAGCTTGGGGAACAGG - Intergenic
1057171792 9:92967336-92967358 AGGTGAAGACGCTCTGGAGATGG - Intronic
1057519008 9:95746161-95746183 AAGTGAAGACTATGGGGAGAGGG - Intergenic
1057699146 9:97350234-97350256 TGGTGAGGATCCTGGGGACATGG - Intronic
1057821356 9:98333525-98333547 GGGAGAAGGCCATGCGGAGATGG - Intronic
1057915990 9:99055537-99055559 GGCTGAGGTCCCTGGAGAGAAGG + Intronic
1058951819 9:109911006-109911028 AGGTGAAGACACAGGGGAGAGGG + Intronic
1059779057 9:117507706-117507728 TGGTAATGAGCCTGGGGAGAGGG + Intergenic
1060827279 9:126694421-126694443 GCGTGAAGGGCCTGGGGAGTCGG + Intronic
1061366373 9:130174033-130174055 GGGTGAAGCCCCTGGGCACAGGG + Intronic
1061426313 9:130500580-130500602 GGGAGAGGACCCTGGGCAGATGG - Intronic
1061452023 9:130672781-130672803 GGTTTCAGACCCTGTGGAGAAGG + Intronic
1061875879 9:133543768-133543790 GAGAGAGGAGCCTGGGGAGAAGG - Intronic
1062309331 9:135927471-135927493 GGGTGCAGCCCCTGGGGACAAGG - Intergenic
1062338308 9:136082201-136082223 GGGTGAAGACCCTGGGGAGACGG - Intronic
1062452421 9:136621217-136621239 GGGAGAGGAGCCTGCGGAGAGGG - Intergenic
1062743123 9:138192653-138192675 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1062743372 9:138194654-138194676 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1062743621 9:138196655-138196677 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1203368487 Un_KI270442v1:279182-279204 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1186913372 X:14193463-14193485 GGATGGAGCCCCTGGGGGGAGGG - Intergenic
1187098406 X:16169289-16169311 AGGTGAAGAGCCTGGGTAAAAGG + Intronic
1187500375 X:19833716-19833738 GAGAGAAGACCCTGGGAAGGAGG - Intronic
1189963069 X:46343776-46343798 AGGAGAAGACCCTGGGAGGAAGG - Intergenic
1190520923 X:51279241-51279263 CGGGGGAGACCGTGGGGAGACGG - Intergenic
1190604437 X:52126416-52126438 GGATGCAGACCCTGGGGTAAAGG + Intergenic
1190778793 X:53577525-53577547 GGAAGGAGACCGTGGGGAGAGGG - Intronic
1190839338 X:54130021-54130043 AGAGGGAGACCCTGGGGAGAGGG + Intronic
1191952040 X:66602886-66602908 TGGGGAAGGCCCTAGGGAGAAGG - Intronic
1192227688 X:69240764-69240786 GAGTGTCGACCCTGGGGAAAGGG + Intergenic
1193258785 X:79380562-79380584 GGATGAAGCTCCTGGGGGGAAGG + Intergenic
1195473553 X:105260077-105260099 GGGTGGAGACCCTGGTTGGAAGG + Intronic
1197422825 X:126258990-126259012 GGGTGCAGACGCTGGGCTGAAGG - Intergenic
1197489588 X:127100972-127100994 GGATGGAGTCCCTAGGGAGAGGG + Intergenic
1197493914 X:127153894-127153916 GGTTGCAGCCCCTGTGGAGATGG + Intergenic
1197969729 X:132102213-132102235 GAGAGAAGTCCATGGGGAGAGGG - Intronic
1198183555 X:134233195-134233217 GGGAGAAGACCATGGGAAGACGG + Intergenic
1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG + Intergenic
1199436078 X:147814276-147814298 AGCTGAAGACCCTGGGGTGCTGG + Intergenic
1200123660 X:153803168-153803190 GAGAGAAGCCCCTGAGGAGAAGG - Exonic
1201070210 Y:10141120-10141142 GGATGAAGTCCCCAGGGAGATGG - Intergenic
1201756718 Y:17494287-17494309 GGATGAAGTCCCCAGGGAGATGG + Intergenic
1201844835 Y:18411697-18411719 GGATGAAGTCCCCAGGGAGATGG - Intergenic
1202045962 Y:20737685-20737707 GGGTGGGGACCCTTGGGACAGGG - Intergenic
1202297059 Y:23370310-23370332 GGATCAAGATCCTGGAGAGAAGG + Intergenic
1202573748 Y:26300287-26300309 GGATCAAGATCCTGGAGAGAAGG - Intergenic