ID: 1062338343

View in Genome Browser
Species Human (GRCh38)
Location 9:136082312-136082334
Sequence CAGAGCCCGGACTTGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062338343_1062338354 11 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338354 9:136082346-136082368 CCACGTGCTGAGCCGGCGGATGG No data
1062338343_1062338359 29 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338359 9:136082364-136082386 GATGGGCCTCCGGGATGCTCAGG No data
1062338343_1062338355 12 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338355 9:136082347-136082369 CACGTGCTGAGCCGGCGGATGGG No data
1062338343_1062338357 20 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338357 9:136082355-136082377 GAGCCGGCGGATGGGCCTCCGGG No data
1062338343_1062338350 4 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338350 9:136082339-136082361 GCCTGTGCCACGTGCTGAGCCGG No data
1062338343_1062338352 7 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338352 9:136082342-136082364 TGTGCCACGTGCTGAGCCGGCGG No data
1062338343_1062338356 19 Left 1062338343 9:136082312-136082334 CCCAAGGCCAAGTCCGGGCTCTG 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1062338356 9:136082354-136082376 TGAGCCGGCGGATGGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062338343 Original CRISPR CAGAGCCCGGACTTGGCCTT GGG (reversed) Intronic
900622251 1:3592869-3592891 CAGATCCTGGACTTGAGCTTTGG - Intronic
900666447 1:3818441-3818463 CAGACCCAGGACTTGGCCGGTGG - Intronic
902227070 1:15003122-15003144 CAGAGCTGGGATTTGGACTTGGG + Intronic
902243741 1:15105608-15105630 CAGAGCCCAGATTTGACCTTGGG + Intronic
902302811 1:15514528-15514550 CAGAGCTAGGACTTGGGCCTAGG - Intronic
902448647 1:16483595-16483617 CAGGGCCTGGACCTGGCCTGGGG + Intergenic
902506131 1:16939765-16939787 CAGGGCCTGGACCTGGCCTGGGG - Intronic
902999701 1:20256337-20256359 CAGAGCAAGGGCTTGGCCTTTGG - Intergenic
903384989 1:22920337-22920359 CAGGGCCAGGAATTTGCCTTGGG + Intergenic
903572997 1:24320074-24320096 CAGAGCCTGGATTTGAACTTAGG - Intronic
903673103 1:25047966-25047988 CAGAGGCTGGACCTGGCCCTTGG - Intergenic
903710046 1:25316707-25316729 CAGAGCTGGGACTTGAGCTTGGG + Intronic
903717070 1:25375699-25375721 CAGAGCTGGGACTTGAGCTTGGG - Intronic
904255270 1:29250747-29250769 CAGAGCTGGGACTTGGCTTTGGG + Intronic
904557748 1:31376310-31376332 CAGAGCTCAGACTAGGTCTTAGG - Intronic
904819443 1:33231948-33231970 CAGAGCCTGGACTTGGTTCTTGG + Intergenic
908277540 1:62491161-62491183 CAGAGCCAGGATTTGAACTTTGG + Intronic
915916153 1:159942118-159942140 CATAGCCCAGACCTGTCCTTAGG + Intronic
917790926 1:178498263-178498285 CAGAGCCTAGACTGGGCCTGGGG - Intergenic
919301293 1:195770110-195770132 GAGAGCCAGGATTTGGGCTTAGG - Intergenic
920453923 1:206083244-206083266 CAGAGCTGGGACTTGATCTTAGG + Intronic
921587730 1:216967252-216967274 CAAAGCCCAGACTTTGCATTAGG + Intronic
921845847 1:219880922-219880944 CAGAGCCAGGACTTGAACCTAGG - Intronic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1065127800 10:22590987-22591009 CACAGCGCGGGCTGGGCCTTGGG + Intronic
1066504014 10:36023329-36023351 CAGAGCCCTGCCTGGGCCGTGGG + Intergenic
1067205762 10:44211446-44211468 CAGAGCATGGACTTGAACTTAGG + Intergenic
1067523655 10:47026087-47026109 CAGTGACCGGAGGTGGCCTTGGG - Intergenic
1074190971 10:111137019-111137041 CAGAGCCAGGACTTAAACTTGGG + Intergenic
1074203969 10:111265636-111265658 CAGAGCGCAGACTGGGCATTTGG + Intergenic
1075978733 10:126719323-126719345 CAGCGGCCACACTTGGCCTTTGG + Intergenic
1076720225 10:132389204-132389226 CAGAACCCGGCGTGGGCCTTGGG + Intergenic
1076752092 10:132548357-132548379 CAGAGGCCTGGCCTGGCCTTTGG - Intronic
1077307674 11:1875260-1875282 CAGCGCCTGGACTTGGACATCGG - Intronic
1077330470 11:1981945-1981967 CAGAGGCAGGTCTAGGCCTTGGG + Intronic
1080619465 11:33975031-33975053 CAGAGCACGGCCATGGCGTTTGG - Intergenic
1080880196 11:36312600-36312622 CAGAGCCAGGACTTGAACATTGG - Intronic
1081416606 11:42822773-42822795 CAGAGCCAGGACTTGGCCCTGGG - Intergenic
1082803646 11:57432614-57432636 CAGAGCCAGGACTGGACCCTGGG - Intergenic
1083257045 11:61503016-61503038 CAGAGCCCAGGCGTGGCCTGGGG - Intergenic
1083308022 11:61770816-61770838 CAGAGCCAGGACTGGGCCCGGGG + Intronic
1083751311 11:64762329-64762351 CACAGCCCGCACTTGTCCCTTGG + Intergenic
1083949340 11:65945468-65945490 CAGAGGCAGGACTTGGGCCTGGG + Exonic
1084310742 11:68314742-68314764 GAGGGCCCGGCCTTGGCCTTGGG - Intronic
1084438706 11:69158410-69158432 CTGAGACAGGACGTGGCCTTTGG - Intergenic
1085050711 11:73378798-73378820 TAGAGCCTGGACCTGGCTTTGGG + Intronic
1088035013 11:105300718-105300740 CAGAGCCTGCACTAGGACTTGGG - Intergenic
1088921170 11:114260664-114260686 CAGAGCTGGGCCCTGGCCTTGGG + Intronic
1089064725 11:115653851-115653873 CAGTGCCAGGACTTGGAATTGGG - Intergenic
1089291917 11:117442817-117442839 AAGAGCCCTGACTTGGCGCTGGG + Intronic
1202813448 11_KI270721v1_random:37124-37146 CAGAGGCAGGTCTAGGCCTTGGG + Intergenic
1091656692 12:2351447-2351469 CAGGGCCAGGAAGTGGCCTTGGG - Intronic
1096871208 12:54593472-54593494 CAGAGCTAGGATTTGGCCTTAGG - Intergenic
1100729327 12:97446646-97446668 AAGAGCCAGGACTTGAACTTAGG - Intergenic
1101481880 12:105106191-105106213 CAGAGCCAGGATTTGGACCTAGG + Intergenic
1101708686 12:107244668-107244690 CAGAGCCAGGACTTGGGCCCAGG + Intergenic
1101904485 12:108814666-108814688 CAGAGACCTGCCCTGGCCTTGGG + Intronic
1102017735 12:109659045-109659067 CAGAGCCAAGACTTGAACTTGGG + Intergenic
1102462517 12:113108781-113108803 CAGAGCCAGGAGTTGGACTTAGG + Intronic
1102594485 12:113982021-113982043 CAGAGCCCTGGCTGGGCCTGGGG + Intergenic
1102993968 12:117334073-117334095 CAGAGGCGGGAATTAGCCTTTGG + Intronic
1104038081 12:125112315-125112337 CAGAGCCCGGAGGCAGCCTTGGG + Intronic
1104595208 12:130115903-130115925 CAGAGGCCGGGCTTGGCCTGGGG + Intergenic
1106483648 13:30154993-30155015 TAGAGCCCGGATTTGGACCTAGG + Intergenic
1106696184 13:32176101-32176123 GAGAGCCCAGACTTGACCCTGGG - Intronic
1107426377 13:40297175-40297197 CAGATTCCGGCCTTGGCCATTGG - Intergenic
1114728522 14:24965246-24965268 GATAACCCAGACTTGGCCTTGGG - Intronic
1117290352 14:54326265-54326287 TAGAGCCAGGGCTTGACCTTAGG - Intergenic
1119548614 14:75491900-75491922 CAGAGCCCGGCTTTGAACTTAGG + Intergenic
1121331414 14:93052105-93052127 CAGAGCTGGGATTTGGCCTGGGG - Intronic
1127573266 15:60264863-60264885 CAGAGCCCAGGCTTCGACTTTGG - Intergenic
1127752475 15:62060010-62060032 CAGGGCCAGGGCTTGGCCTCGGG + Intronic
1128076021 15:64825996-64826018 CAGAGGCTGGGCTTAGCCTTGGG + Intergenic
1128717720 15:69920824-69920846 CAGAGGCCGGATTTGGCCCCAGG - Intergenic
1129034270 15:72640239-72640261 CAGAGCCGGGACGTGGCCCTCGG + Intergenic
1129215612 15:74096977-74096999 CAGAGCCGGGACGTGGCCCTCGG - Intergenic
1129732748 15:77941306-77941328 CAGAGCCGGGACGTGGCCCTCGG - Intergenic
1130853651 15:87821857-87821879 CAGAGCAAGGACTTGAACTTGGG + Intergenic
1131460231 15:92612530-92612552 CAGTGCTGGGACTTGGCCTAAGG - Intergenic
1132517782 16:373903-373925 GAGAGGCCGGACCTGGCGTTGGG - Intronic
1132755374 16:1481963-1481985 CAGAGCAAGGGCTTGGACTTGGG - Intergenic
1132762914 16:1519695-1519717 CAGAGCCCGGGCACAGCCTTGGG - Intronic
1138395981 16:56705191-56705213 CAGAGACAGGACTTGACCCTAGG - Intronic
1139356831 16:66371692-66371714 CAAAGCCCAGACTTGGCCCCTGG + Intronic
1141714778 16:85720469-85720491 CCGACCCTGGACCTGGCCTTTGG - Intronic
1142150422 16:88510217-88510239 CAGAGGCAGGACTTGGCCCCAGG + Intronic
1142643481 17:1298288-1298310 CAGAGGCCGGCCCTGGCCATCGG + Exonic
1143002436 17:3803061-3803083 CAGAGCCTGGCCCTGACCTTGGG - Intergenic
1144477123 17:15597949-15597971 CAGAGCCGGGATTTGGACCTAGG + Intronic
1144921116 17:18765418-18765440 CAGAGCCGGGATTTGGACCTAGG - Intronic
1145797875 17:27666459-27666481 CAGAGGCAGGCCTTGCCCTTGGG - Intergenic
1145812326 17:27771795-27771817 CAGAGCCAGGCCTTGCCCTTGGG - Intronic
1145934378 17:28706303-28706325 CAGACCCACGACTTGGGCTTAGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146669087 17:34724520-34724542 CAGAGCTGGGACTGGACCTTGGG - Intergenic
1146842358 17:36164672-36164694 CAGAGCCAGGCCTTGCCCCTGGG - Intergenic
1146854668 17:36252631-36252653 CAGAGCCAGGCCTTGCCCCTGGG - Intronic
1146865952 17:36335745-36335767 CAGAGCCAGGCCTTGCCCCTGGG + Intronic
1146870568 17:36376523-36376545 CAGAGCCAGGCCTTGCCCCTGGG - Intronic
1146877927 17:36427604-36427626 CAGAGCCAGGCCTTGCCCCTGGG - Intronic
1146947823 17:36885831-36885853 CAGAGCCCCGAGATGTCCTTAGG - Intergenic
1147068822 17:37936357-37936379 CAGAGCCAGGCCTTGCCCCTGGG + Intergenic
1147073451 17:37977147-37977169 CAGAGCCAGGCCTTGCCCCTGGG - Intergenic
1147080345 17:38015894-38015916 CAGAGCCAGGCCTTGCCCCTGGG + Intronic
1147084973 17:38056685-38056707 CAGAGCCAGGCCTTGCCCCTGGG - Intronic
1147096293 17:38139854-38139876 CAGAGCCAGGCCTTGCCCCTGGG + Intergenic
1147100919 17:38180651-38180673 CAGAGCCAGGCCTTGCCCCTGGG - Intergenic
1147320122 17:39640902-39640924 CAGAGCCAGGCTTTGGCTTTGGG + Intronic
1147720342 17:42536167-42536189 CTGAGCCCGGGCTTAGCCTTCGG + Exonic
1148718954 17:49736904-49736926 CAGAGCCTGCCCTTGGCCTCAGG - Intronic
1150998402 17:70345795-70345817 CAGAGAAGGGACTTGGTCTTTGG + Intergenic
1151879095 17:76884293-76884315 AAGAGGCTGGACTTGGCTTTGGG + Intronic
1151951703 17:77357872-77357894 CAGAGCCAGGATTAGGGCTTGGG - Intronic
1152163091 17:78681700-78681722 CAGTGCTAGGACTTGGCCATGGG - Intronic
1153017552 18:597208-597230 CGGAGCTCGGCCTTGGACTTGGG - Intronic
1153947393 18:10029866-10029888 CAGAGCCCGGACTTGTGATAAGG - Intergenic
1156154619 18:34287302-34287324 GAGAGACTGGACTTGGACTTGGG - Intergenic
1157399740 18:47377511-47377533 CAGAGCCCTGATTTAGACTTGGG + Intergenic
1157569473 18:48703112-48703134 CAGGGTCTGGACTTGGCCTGAGG + Intronic
1157683642 18:49626277-49626299 CAGAGCCCTTCCATGGCCTTGGG + Intergenic
1158158016 18:54447265-54447287 CAGAGACTGGACTAGGCTTTAGG + Intergenic
1160799798 19:962468-962490 CAGAGCCAGGGCGTGGCCCTGGG + Intronic
1160918496 19:1508708-1508730 CAGAGCCAGGACTGGACCGTAGG + Intronic
1161338741 19:3729118-3729140 CAGGGCTCGGACTTGGCAGTAGG + Intronic
1161767078 19:6213884-6213906 CAGAGGCCGGGCTTAGCCCTGGG - Intronic
1162801489 19:13113126-13113148 CTGAGCCAGGACTTGAACTTGGG - Intronic
1163636128 19:18437930-18437952 GAGAGCCCGGACGTGGTCTACGG - Exonic
1165447173 19:35862659-35862681 CAGTGACCTGACCTGGCCTTGGG + Intronic
925882534 2:8365078-8365100 CTGAGCCCGCTCTTGGCCTCAGG + Intergenic
927917552 2:26946694-26946716 CAGAGCCTGGACTTGGACCCAGG - Intronic
928364385 2:30690162-30690184 AACAGCCCGGTCTTGGCATTTGG - Intergenic
928832353 2:35502517-35502539 CAGAGCCCACATTTGTCCTTGGG + Intergenic
930027944 2:47040839-47040861 CAGAGCTTGGACTTTGGCTTGGG + Intronic
934522887 2:95030968-95030990 CAGAGCCGGGACTGGGCCATGGG + Intronic
935339061 2:102043489-102043511 CAGAGCAGGGACTTGAACTTAGG + Intergenic
936231469 2:110704183-110704205 CAGAGCCAGGGCTTTACCTTGGG + Intergenic
936680257 2:114761829-114761851 CAGAGCCCTCACTTGGAATTTGG - Intronic
937999888 2:127724545-127724567 CAAAGCCTGGACTTGGACTCTGG + Intronic
938127145 2:128682750-128682772 CAGAGCACTGACTTGGAGTTGGG - Intergenic
938219292 2:129551820-129551842 AAGAGCCAGGCCTTGGCCTCGGG + Intergenic
938746234 2:134281010-134281032 CACAGCCTGGACCTGGTCTTTGG + Intronic
941719265 2:168796248-168796270 CAGAACCGGGAGTTGGCCTTCGG + Intronic
946911921 2:224470915-224470937 CAGAGCCAGGAGTTGGACCTAGG - Exonic
1168958228 20:1849455-1849477 CTGAGCCCGGATATGGCCTCAGG + Intergenic
1169896535 20:10510537-10510559 GAGAGCCTGGCCATGGCCTTAGG + Intronic
1171185445 20:23121187-23121209 CAGAGCCCAGACTGTGGCTTTGG - Intergenic
1172095413 20:32457761-32457783 CAGAGCCCGGAGCTGCCCTGCGG - Intronic
1172654216 20:36527008-36527030 CAGAGCCTGGTCTGGGCCTCCGG - Exonic
1173497994 20:43532932-43532954 GAGGGCCCAGACTTGGCCTCAGG + Intronic
1173924118 20:46768159-46768181 CAGAGCCATGACTTGGGCTGAGG - Intergenic
1174116385 20:48229365-48229387 AAGAGACCTGACCTGGCCTTGGG - Intergenic
1174547238 20:51334629-51334651 CGGAGCCTGGACTTGGTCCTGGG + Intergenic
1175158953 20:56993921-56993943 CAGAGCCAGGACTTGAACTGAGG + Intergenic
1176510404 21:7743940-7743962 CAGAGCTGGGACTTGACCCTGGG - Intergenic
1178416247 21:32407543-32407565 CAGAGCTGGGACTTGACCTGAGG + Intergenic
1178644517 21:34374469-34374491 CAGAGCTGGGACTTGACCCTGGG - Intergenic
1179291349 21:40020805-40020827 CAGAGTCCTGCCTGGGCCTTTGG + Intronic
1179784407 21:43721222-43721244 CAGAGCCTGGAAATGGCCTTGGG + Intronic
1179786521 21:43733441-43733463 CGGAGGCCGGGCTTGGCCCTGGG + Intronic
1181109323 22:20592039-20592061 CAGATCCTGGACTTGGACCTGGG - Intergenic
1181573037 22:23778177-23778199 CAGAGCCAGGCCTTAGCCTTAGG + Intronic
1182356492 22:29724536-29724558 GAGAGCTGGGACTTGACCTTGGG + Intronic
1182434784 22:30323554-30323576 CAGAACTAGGACTTGGACTTAGG - Intronic
1183262371 22:36803883-36803905 CAGAGCCAGGACTTGGCCTCTGG + Intronic
1184318911 22:43723848-43723870 CAGAGTCCGGAGATGGCCCTGGG + Intronic
1185235733 22:49711860-49711882 CAGGGCCCAAACCTGGCCTTGGG - Intergenic
949946502 3:9193829-9193851 CACAGCCAGGATTTGCCCTTAGG - Intronic
950201932 3:11050648-11050670 CTGAGCCCTGACCTGTCCTTAGG - Intergenic
952820902 3:37484723-37484745 CAGAGCCGGGACTTGAACTCCGG - Intronic
953871218 3:46629252-46629274 CACAGCCCGGAGTTGGGCCTGGG - Intergenic
954801478 3:53189478-53189500 CAGAGCCAGCATTTGGCCTCGGG - Intronic
955867371 3:63399381-63399403 CAGAGCCTGAATGTGGCCTTGGG + Intronic
956014551 3:64867829-64867851 CAGAGCCCTGACTTAAGCTTGGG + Intergenic
956857810 3:73293225-73293247 CAGAGGCTGGATTTGGCCTGTGG - Intergenic
958874405 3:99599400-99599422 CAGAGCCAGGACTTGAACCTGGG - Intergenic
958926120 3:100158989-100159011 CATATCCCGGCCTTTGCCTTAGG + Intronic
959373498 3:105558972-105558994 CAGAGAGGGGTCTTGGCCTTGGG - Intronic
960962522 3:123082321-123082343 CAGAGCCAGGACTAGAACTTGGG - Intronic
962205034 3:133427428-133427450 CAGAGCCAGGACTTGAACCTTGG + Intronic
962720962 3:138174564-138174586 CCGGGCCCGGACTTGGCGGTGGG - Intronic
965609580 3:170530457-170530479 CAGAGCCAGAGCTTGGCCCTGGG + Intronic
966910810 3:184558979-184559001 CTGAGCCAGGATTTGGACTTAGG + Intronic
966927439 3:184654518-184654540 CACAGCCCAGCCTTGGCCTAGGG - Intronic
967522149 3:190445096-190445118 CAGAGCTTGGACTTGGACCTGGG - Intronic
967814511 3:193787708-193787730 CAGAGCGCTGCATTGGCCTTTGG + Intergenic
969185011 4:5468403-5468425 CAGAGCCAGGACTTGGCCCCAGG - Intronic
969371325 4:6733288-6733310 CAGGGCCAGGACTGGGCCTCAGG - Intergenic
971308557 4:25505024-25505046 CAGAGCCAGGACGTGGTCTTTGG + Intergenic
978715023 4:111831606-111831628 CTGAGCCCCGACTTGTCCTGTGG - Intergenic
986451450 5:7869367-7869389 TGGGGCTCGGACTTGGCCTTTGG + Intronic
992268410 5:75040480-75040502 CAGAGCCCAGACTAGAACTTAGG - Intergenic
992501345 5:77347326-77347348 CAGAGCCAGGATTTGAACTTGGG + Intronic
995512054 5:112920075-112920097 CAGAGCCCGGGGTAGGCCTCAGG + Intronic
997222571 5:132181412-132181434 CAGTGCCCAGAATGGGCCTTTGG - Intergenic
997248469 5:132370712-132370734 CAGAGCCAGGACTTGGGCCAGGG + Intronic
998063015 5:139133915-139133937 CAGAGCCAAGAATTGGCCTTAGG - Intronic
998157410 5:139794950-139794972 CAGGGCCTTGACTTGCCCTTGGG + Intergenic
999412555 5:151365128-151365150 CAGTGCCCTGATTTTGCCTTGGG - Intergenic
999565499 5:152855875-152855897 CAGAGCCGGGACTTTGGCATTGG - Intergenic
1001562605 5:172679107-172679129 CAGCACCGGGACTTGGCCTCCGG - Intronic
1001919726 5:175590478-175590500 GAGAGCCAGGACCAGGCCTTTGG - Intergenic
1002204526 5:177553866-177553888 CAGAGCCCCGAGATGGCCTGTGG + Intronic
1002576200 5:180175482-180175504 AAGAGCCCGGCCTTGGGCTCAGG + Intronic
1005051150 6:21685144-21685166 CAGAGCGAGAACTTGGCATTAGG - Intergenic
1005445117 6:25914969-25914991 CAGAGCCAGGATTTGGACTGGGG - Intronic
1005594180 6:27363028-27363050 CAAAGCCAGGACTTGGACTCAGG + Intergenic
1013667809 6:112366389-112366411 CAGAGGCTGGTCTTGGCCTATGG - Intergenic
1015036879 6:128666933-128666955 CAAAGCTGGGACTTTGCCTTTGG + Intergenic
1016490367 6:144593623-144593645 CTCAGCCATGACTTGGCCTTAGG + Intronic
1019331196 7:461718-461740 CAGAGACCGGAGGTGGCCTGGGG - Intergenic
1019388216 7:770612-770634 CAGAGCCCGGACCTACCCCTGGG - Exonic
1020017569 7:4840344-4840366 AAGTGCCCCCACTTGGCCTTTGG + Intronic
1021387174 7:20045340-20045362 GAGAGCCCTGACTTGCCCTTTGG - Intergenic
1022291119 7:29004587-29004609 AAGAGCACGGACTTGGGATTTGG + Intronic
1024522392 7:50316827-50316849 AAGAGCCTTGACTTTGCCTTAGG + Intronic
1035373012 7:158391363-158391385 CAGGGCCCGGACCTGGATTTCGG - Intronic
1035478257 7:159159023-159159045 CATAGCCCTGACCTGGCCTGCGG - Intergenic
1035709489 8:1701383-1701405 CAGAGCCGGGTCTGGGCCTCGGG - Exonic
1035980543 8:4365669-4365691 CAGAGGCTGGAGTTTGCCTTAGG - Intronic
1037626261 8:20609666-20609688 CAGAACCAGGATTTGGACTTGGG + Intergenic
1039912241 8:41834619-41834641 CAGGGTCCGGAGCTGGCCTTAGG + Intronic
1040589507 8:48777640-48777662 CAGAGCCCTTCCTTGCCCTTGGG - Intergenic
1043999138 8:86856759-86856781 CAGAGCCTGGAAATGGCCTAAGG - Intergenic
1044785006 8:95784054-95784076 CAGAGCTAGGACTTGGCATCTGG - Intergenic
1048437864 8:134434335-134434357 CAGAGCCAGGATTTGGCCCCAGG - Intergenic
1058529751 9:105893941-105893963 CAAAGACCTGACTTGTCCTTTGG + Intergenic
1058897044 9:109409482-109409504 CAGAGCAGGCACTTGGCCTTCGG + Intronic
1061153961 9:128846000-128846022 CAGAGTTAGGACATGGCCTTGGG - Intronic
1061399615 9:130361286-130361308 CAGGGCACTGACTTGGCCTGTGG + Intronic
1061502043 9:131009524-131009546 CAGAGCCCGTCCATGGCCTTCGG + Exonic
1061642078 9:131966717-131966739 CAGAGCAAGGACTTGAACTTGGG - Intronic
1061678247 9:132230287-132230309 CAGAGCCGTGACTTGCCCTTGGG - Intronic
1062338343 9:136082312-136082334 CAGAGCCCGGACTTGGCCTTGGG - Intronic
1187411403 X:19053518-19053540 CAGAGCCAGGATTTGGACCTAGG - Intronic
1190178062 X:48167719-48167741 GACAGCCCACACTTGGCCTTGGG - Intergenic
1190180088 X:48184708-48184730 GACAGCCCACACTTGGCCTTGGG + Intergenic
1190193105 X:48293928-48293950 GACAGCCCACACTTGGCCTTGGG + Intergenic
1190197180 X:48329505-48329527 GACAGCCCACACTTGGCCTTGGG - Intergenic
1190420785 X:50282272-50282294 CAGAGCCAGAACTAGACCTTAGG + Intronic
1190659610 X:52642541-52642563 GACAGCCCACACTTGGCCTTGGG + Intergenic
1190677117 X:52791803-52791825 GACAGCCCACACTTGGCCTTGGG - Intergenic
1190713596 X:53086647-53086669 CTGTACCCGGCCTTGGCCTTTGG + Intronic
1190936402 X:55002368-55002390 CAGAGCCCGGAGTTCCTCTTGGG - Exonic
1192535972 X:71928205-71928227 CAGAGCCAGGATTTGACCCTGGG + Intergenic
1193654893 X:84187595-84187617 CTGGGCCCGGGCTCGGCCTTGGG - Intronic
1195761993 X:108256555-108256577 CAGAGCCAGGATTTGAACTTGGG + Intronic
1195941588 X:110172134-110172156 CAGAGCCAGGACTTGAACTTGGG - Intronic
1196065154 X:111456128-111456150 GAGAGCCAGGACTTGAACTTAGG - Intergenic
1198680048 X:139171536-139171558 CAGAGCCCTGACTGGGGCATAGG - Intronic
1200008886 X:153106974-153106996 CAGAGCCTGGCCTTTGCCTAGGG - Intergenic
1200030714 X:153292948-153292970 CAGAGCCTGGCCTTTGCCTAGGG + Intergenic