ID: 1062338699

View in Genome Browser
Species Human (GRCh38)
Location 9:136083970-136083992
Sequence CTTCTCCCGCATCACTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062338690_1062338699 -4 Left 1062338690 9:136083951-136083973 CCTCTCCGCCTCACCCCAACTTC 0: 1
1: 0
2: 3
3: 57
4: 506
Right 1062338699 9:136083970-136083992 CTTCTCCCGCATCACTGGGTGGG No data
1062338691_1062338699 -9 Left 1062338691 9:136083956-136083978 CCGCCTCACCCCAACTTCTCCCG 0: 1
1: 0
2: 2
3: 50
4: 541
Right 1062338699 9:136083970-136083992 CTTCTCCCGCATCACTGGGTGGG No data
1062338689_1062338699 27 Left 1062338689 9:136083920-136083942 CCAGAGACAGATGCAGTCAAAGC 0: 1
1: 0
2: 0
3: 21
4: 257
Right 1062338699 9:136083970-136083992 CTTCTCCCGCATCACTGGGTGGG No data
1062338688_1062338699 28 Left 1062338688 9:136083919-136083941 CCCAGAGACAGATGCAGTCAAAG 0: 1
1: 0
2: 0
3: 28
4: 328
Right 1062338699 9:136083970-136083992 CTTCTCCCGCATCACTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062338699 Original CRISPR CTTCTCCCGCATCACTGGGT GGG Intronic
No off target data available for this crispr