ID: 1062341056

View in Genome Browser
Species Human (GRCh38)
Location 9:136094237-136094259
Sequence CCTCCCCCAACCCCCGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 354}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062341056_1062341064 -6 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341064 9:136094254-136094276 GGGAGGGAGTGGAACGGCCTGGG No data
1062341056_1062341065 -3 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341065 9:136094257-136094279 AGGGAGTGGAACGGCCTGGGAGG No data
1062341056_1062341066 8 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341066 9:136094268-136094290 CGGCCTGGGAGGCCAACTCCAGG No data
1062341056_1062341071 23 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341071 9:136094283-136094305 ACTCCAGGGACCCGGCCTCGCGG No data
1062341056_1062341067 9 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341067 9:136094269-136094291 GGCCTGGGAGGCCAACTCCAGGG No data
1062341056_1062341069 15 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341069 9:136094275-136094297 GGAGGCCAACTCCAGGGACCCGG No data
1062341056_1062341063 -7 Left 1062341056 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 354
Right 1062341063 9:136094253-136094275 GGGGAGGGAGTGGAACGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062341056 Original CRISPR CCTCCCCCAACCCCCGCGCG GGG (reversed) Intronic
900116990 1:1033180-1033202 GCGCCCCCGACTCCCGCGCGGGG - Intronic
900140774 1:1138764-1138786 CCTCCCCCAAGCACAGCGTGTGG - Intergenic
902509976 1:16961143-16961165 CCTCCCCCCTTCCCTGCGCGCGG - Intronic
902551114 1:17220118-17220140 CCTCCCCCATCCCCCACTCCTGG - Intronic
903875880 1:26472738-26472760 CCGTCTCCAGCCCCCGCGCGGGG - Intronic
904431296 1:30466208-30466230 CCTCCACCAACCCTCGCTCTTGG - Intergenic
904690923 1:32292650-32292672 CCTCCCCCAGCCTCTGAGCGGGG + Intronic
905333848 1:37229699-37229721 CATCCCCCAACCCCAGCCCCTGG + Intergenic
906399022 1:45491182-45491204 CCGCCCCCAACCCCCCTGCTGGG - Intergenic
906524298 1:46485560-46485582 CCACCCCCAATCCCAGCGCAAGG - Intergenic
906534304 1:46543310-46543332 CCTCCCCCCGCCCCCCCGCTGGG - Intergenic
906636929 1:47416221-47416243 CCCCCCCCAACCACCGCCGGGGG - Exonic
907188999 1:52633276-52633298 CCTGCCCCTACCCCTCCGCGCGG + Intergenic
909170342 1:72285270-72285292 CCACCCCCAACCCACCCCCGTGG - Intergenic
912793435 1:112675094-112675116 GCTGCCACGACCCCCGCGCGAGG + Intronic
914803093 1:150974566-150974588 CCCCTTCCCACCCCCGCGCGGGG + Intronic
915165688 1:153946630-153946652 ACTCCCCCAACCCCCGCTCCGGG + Exonic
915629089 1:157138172-157138194 CCTCCCCCGCCCCCCGCACTGGG + Intronic
916986014 1:170191957-170191979 TCACCCCCAACCCCCGACCGGGG + Intergenic
917905833 1:179586618-179586640 CCTCCTCCACCCGCCGCGGGAGG + Intergenic
918282818 1:183023143-183023165 CCTCCCCCAACCCCCTCCCCCGG + Intergenic
918780219 1:188690462-188690484 CCTCCCCCCACCCCCCCGGCAGG + Intergenic
919155864 1:193764955-193764977 CCCCCCCCACCCCCCCCCCGAGG - Intergenic
919800778 1:201353504-201353526 CTTCCCCCAACCCCCGCCCCAGG + Intergenic
919852614 1:201683375-201683397 CATCCCCCAACCCCTGTCCGTGG - Intronic
920377372 1:205516434-205516456 CGTCCCCCAACCCCTGCCCCTGG + Intronic
920409769 1:205750019-205750041 CCCCCCCCACCCCGCGCGCTCGG + Exonic
920528740 1:206686154-206686176 CCCCCTCCCACGCCCGCGCGGGG + Intronic
920694843 1:208174405-208174427 CCTCCTCCCACCCCCACCCGCGG - Intronic
921649124 1:217656024-217656046 CCTCCCCCACCCCCCACGCCCGG + Intronic
922513304 1:226187020-226187042 CCTACTCCGACCCCCGCGCGGGG - Intergenic
1062825355 10:564210-564232 GTTCCCCCCACCCCCGCACGTGG + Intronic
1064243414 10:13650617-13650639 CCTCCCCCAGCCCCAGTGCCAGG - Intronic
1065637381 10:27745368-27745390 CCTCCCAGGACTCCCGCGCGCGG + Intronic
1066023128 10:31321106-31321128 CCAGCCCCACCCCCCGCGCCTGG + Intronic
1067227269 10:44384388-44384410 CCTCTCCCCACACCCTCGCGGGG - Intronic
1067475115 10:46559620-46559642 CATCCCCCAACCCACGCCAGTGG - Intergenic
1067477037 10:46574078-46574100 CCACCCCCTGCCCCCGCGAGAGG - Intergenic
1067699187 10:48556372-48556394 CCTTCCCCAACCCCCAGGCTAGG + Intronic
1067713637 10:48670804-48670826 CCACCCCCACCCCCCGCTGGTGG - Intergenic
1069403625 10:68075312-68075334 CCTCCCCCGCCTCCCTCGCGTGG - Intronic
1069542683 10:69307273-69307295 CCACCCCCACCCCCCGGGGGAGG + Intronic
1069870297 10:71528835-71528857 CCTCCCCCATCCCCAGCATGTGG - Intronic
1069874216 10:71551830-71551852 CCTCCCACAACCCCTGCGGCAGG + Intronic
1070951645 10:80436040-80436062 CCGCCCCCAACCCCCGCACCAGG - Exonic
1072344438 10:94489371-94489393 CCTCCCCCAACCCCTGGCAGTGG - Intronic
1073146745 10:101286139-101286161 CCACCCCCACCCCCAGCGGGCGG - Intergenic
1073580903 10:104664792-104664814 CCTCCCCCAAACCCCTCATGTGG + Intronic
1074113256 10:110437476-110437498 CCTCCCCCAGCCCCCATGCAAGG + Intergenic
1075114786 10:119617087-119617109 CCTCCACCAGCGCCCCCGCGTGG - Intergenic
1075701285 10:124470732-124470754 CCTCATCCAACCCCCACACGCGG + Intronic
1075784787 10:125041764-125041786 CCTCCCCCAACCCCCGAGTGAGG + Intronic
1076422484 10:130341059-130341081 CATCCCCCAACCCCCACAGGGGG - Intergenic
1076606251 10:131691705-131691727 CCCCCCCCAACCCCTGCTCCCGG + Intergenic
1076639721 10:131906216-131906238 CCTCCCCCAACCCCTCCCCACGG - Intronic
1076948127 10:133665464-133665486 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076949117 10:133668774-133668796 CCACCCCCACCCCCCGCCCCCGG + Intronic
1076950101 10:133672073-133672095 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076951085 10:133675372-133675394 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076952075 10:133678682-133678704 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076953064 10:133681992-133682014 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076954048 10:133685291-133685313 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076955032 10:133741643-133741665 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076956021 10:133744953-133744975 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076957011 10:133748263-133748285 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076957998 10:133751572-133751594 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076958983 10:133754871-133754893 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076959972 10:133758181-133758203 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076960956 10:133761480-133761502 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1077008722 11:370668-370690 TCTCCCCCAACCCCACCGCCAGG - Intronic
1077051312 11:568277-568299 CCCCCCGCAGCCCCCGCGGGAGG + Intergenic
1077119331 11:899637-899659 CCTCCCCCAACCCCACCCCGGGG + Intronic
1077405846 11:2382215-2382237 CCACCCCCACCCCCCGCACAAGG + Intronic
1078377683 11:10809352-10809374 CCTCCCCCGAACCCTGTGCGTGG + Intergenic
1078659919 11:13278148-13278170 CCGCCCCCATCCTCCTCGCGGGG + Intronic
1079128446 11:17734624-17734646 CCTCCCTCAACCTCGGCGCTGGG - Intergenic
1080387130 11:31816848-31816870 CCGCCCCAAACTCCCGGGCGGGG + Intronic
1080404386 11:31965859-31965881 CCTCCCCCAACTCCCCCTGGAGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083433058 11:62624938-62624960 CCTCCCCCAACCCCCCACCCAGG + Exonic
1083583397 11:63839372-63839394 CCTCCCCGCACCCCCGGCCGGGG + Exonic
1083617873 11:64035535-64035557 CCTCCCCCAACTCCCCAGAGGGG + Intronic
1085396885 11:76210851-76210873 CCGCCCCCGCCCCCCGCGCGCGG - Intergenic
1087188566 11:95230143-95230165 CCTCCCCCAACCCCAGCCTCAGG + Intronic
1088904317 11:114142840-114142862 CCTCCCCCATCCCCATCGGGAGG + Intronic
1091498277 12:991160-991182 CCGCCCCCAGCCCCGCCGCGGGG - Intronic
1093259563 12:16918336-16918358 CCTCCCCCAACCCCAGGCAGCGG - Intergenic
1096259178 12:50080477-50080499 CCTCCCCCAATCCCTGTGCAGGG + Exonic
1096748373 12:53743364-53743386 GCTCCCCCAACCCCAGCTCCTGG + Intergenic
1096979266 12:55719073-55719095 CCTCCTCCAACCCCCCAGTGTGG + Exonic
1097192706 12:57227053-57227075 CCTCCCCCAACCCCTGCCTCCGG + Intergenic
1098106070 12:67069649-67069671 CCTCCCCCGAGACGCGCGCGAGG + Intergenic
1099955891 12:89352463-89352485 CCTCGCACACCCCCTGCGCGAGG + Exonic
1101370281 12:104122689-104122711 CCTCCCCTGACCCCAGAGCGTGG + Intronic
1102928938 12:116847996-116848018 CCTCCCCCAGCCCCCGCAACAGG + Intronic
1103364059 12:120369450-120369472 CCCCCACCCACCCCGGCGCGGGG + Intergenic
1103678686 12:122676724-122676746 CCTCCCCCAACCCCCTCCGTGGG - Intergenic
1103722207 12:122980975-122980997 CCTCACCCACCCCCAGCGCTGGG - Exonic
1103764369 12:123270816-123270838 ACTGCCCCCACGCCCGCGCGCGG + Intronic
1104077881 12:125406662-125406684 CCTTCTCCAACCCCCGCCCATGG + Intronic
1104894045 12:132153251-132153273 CCTGCCCCCACCCCCGTGGGAGG + Intergenic
1106032027 13:26012630-26012652 CCTCCATCAGCCCCCGCCCGCGG - Intronic
1106956195 13:34942148-34942170 CCTCCCCCAACCACCCCGAACGG - Intergenic
1107812722 13:44215691-44215713 CCTCCCCCAACTCCCCAGTGTGG - Intergenic
1109995920 13:70125892-70125914 CCTCCCACAACCCCCGGTGGTGG - Intergenic
1111842043 13:93461658-93461680 CCCCCCCCAACCCCCCCGCCGGG - Intronic
1112216452 13:97434849-97434871 CTTCCCCGGAGCCCCGCGCGGGG - Intronic
1112652648 13:101416124-101416146 CCCCACCCCTCCCCCGCGCGGGG + Intronic
1114470361 14:22957041-22957063 CTTCCCCCAGCCCCTGCGCCCGG - Exonic
1114519501 14:23324371-23324393 CCTCCCCCCACCCCTCCCCGTGG + Intronic
1116373831 14:44171871-44171893 CCTCCCCCCACCCCCCCGACAGG + Intergenic
1116671834 14:47851960-47851982 CCTCCCCCAACCCCCCCGACAGG - Intergenic
1118096788 14:62546318-62546340 CCTCCCCCAACCCCTGGCAGTGG + Intergenic
1118776608 14:68977985-68978007 CCTCCCCCCACCACCACGAGTGG + Intronic
1119382754 14:74239500-74239522 GCTCCCCCCACCCCCCCGCCGGG - Exonic
1119438152 14:74611463-74611485 GCGCCCCCAACCCCGCCGCGAGG - Exonic
1121114373 14:91332991-91333013 GCACCCCCGACCCCCGCCCGAGG - Intronic
1122428064 14:101623177-101623199 CCTCCCCCACTCCCCGCACCTGG - Intergenic
1122444945 14:101761577-101761599 GCTCGCCCCACCCCCGCGCCCGG - Intergenic
1122550165 14:102545071-102545093 CCCCCCCCACCCCCCGCCCGGGG - Intergenic
1122637679 14:103138080-103138102 CCTCCCCCACCCCCAGCTCCGGG - Intergenic
1122901076 14:104782556-104782578 CCTCTCCCACCCCCCACGCCTGG - Intronic
1123207971 14:106731983-106732005 CCTCCCCCAACCCCCACAACAGG + Intergenic
1124141112 15:27077940-27077962 CCTCCCCCAAACCCCCGGCGGGG - Intronic
1124607136 15:31178169-31178191 CCTCCCCCACTCCCCGCCCTGGG + Intergenic
1124864745 15:33478094-33478116 CCCCCCCCAACCCCCTCAAGTGG - Intronic
1125200973 15:37100561-37100583 CCTCCCCCACCCCCCCAGCCGGG - Intronic
1125557609 15:40599387-40599409 CCTCCCCCACCCCCCGAGACAGG + Intronic
1127765044 15:62177413-62177435 CCTCCCCCCACCCCCCCGACAGG - Intergenic
1127931752 15:63601448-63601470 GCTCCCCAGACCCCTGCGCGCGG - Exonic
1128312099 15:66637252-66637274 CATCCCCCAACCCCTGTGGGAGG - Intronic
1128322007 15:66701111-66701133 CCGCCCTCTCCCCCCGCGCGCGG - Intergenic
1128455672 15:67830006-67830028 GCACCCCCCACCCCCGCGCCTGG - Intronic
1128460534 15:67863519-67863541 AGTCCCTCAACCCCTGCGCGGGG + Intergenic
1131149249 15:90036658-90036680 CCTGCCCCACCCCCAGCTCGAGG - Intronic
1131873359 15:96781959-96781981 CTTCCTCCAACCCCCGGGGGTGG - Intergenic
1132586000 16:705964-705986 CCCGCCCCGGCCCCCGCGCGCGG + Intronic
1132843429 16:1989617-1989639 CTTCCCCCAACCCACGGGAGAGG - Intergenic
1133078043 16:3295190-3295212 CCTCCTCCAACCGCCGCCCCGGG + Intronic
1133218462 16:4307646-4307668 CCCGCCCCTACCCCCACGCGGGG - Intergenic
1136110993 16:28063575-28063597 CCCCCCCCAACCCCGGGGTGGGG + Intergenic
1136498962 16:30660117-30660139 CCTCCTCCCACCCCAGGGCGGGG - Intronic
1136556559 16:31010654-31010676 CCGCCCCCCTCCCCCGCGCTCGG - Intergenic
1136574930 16:31117805-31117827 TCTCCGCCGACCCCGGCGCGCGG + Exonic
1136627807 16:31472469-31472491 CCTCCCCAGAGCCCCGCGCCCGG - Intronic
1138104865 16:54282552-54282574 ACCCCCGCAACCCCCGCGCCGGG + Intergenic
1138437557 16:57012684-57012706 CCAACCCCAACCCCCGTCCGGGG + Intronic
1139649727 16:68356274-68356296 CCTCACCCCACCCTCGCCCGAGG + Intronic
1139705567 16:68738186-68738208 CCTCCCCCAATCCCGACGCCGGG + Intronic
1140214392 16:72995678-72995700 CCGCCCACAAACCCCGCGCTGGG + Intronic
1140515099 16:75535686-75535708 CCTCTCCCCACCCCCGACCGAGG + Intronic
1141828581 16:86497397-86497419 CCTCGGCCGAGCCCCGCGCGCGG - Intergenic
1142167628 16:88601103-88601125 CCTCCCCCAACTTCCGCAGGCGG - Intronic
1142194423 16:88732915-88732937 ACTCCCCCAGCCCCTGCCCGTGG - Intronic
1142682799 17:1560406-1560428 CCTCCCCCGTCCCCCGCCCAGGG + Intronic
1143135760 17:4711308-4711330 CCTCCCCCACCCCCAGAGAGAGG - Intronic
1143203319 17:5127013-5127035 CCTCCCCCCACCCTGGTGCGGGG - Intronic
1143483307 17:7239138-7239160 CCTCCCCGAACTCCCCCGCTGGG + Intronic
1144874486 17:18390338-18390360 CCTCCCCCCACCCTGGTGCGGGG - Intergenic
1145268002 17:21389707-21389729 CAGCCCCCAACCCCCACGTGGGG - Intronic
1146187256 17:30731931-30731953 CCTCCCCCGGACCCCGCGCTGGG - Intergenic
1146256067 17:31392067-31392089 CCTCCCCCAGCTCCCCCGCCGGG + Intronic
1146332298 17:31937292-31937314 CCTCCCCCGGACCCCGCGCTGGG - Exonic
1147968272 17:44205928-44205950 CCTCCCCCAACCCCACAGCTGGG - Exonic
1148130851 17:45261963-45261985 CCTGCCCCAACCCTCGCCCCCGG + Intronic
1148155901 17:45425216-45425238 CCACCCCCAACCCCCAGGTGGGG - Intronic
1148753122 17:49957339-49957361 CCTCACCCCACCCCCGCAAGTGG + Intergenic
1148765848 17:50037787-50037809 CCTCCCCCAGCCCACCCGCCTGG - Intergenic
1149614804 17:57988421-57988443 CCCACCCCAGCCCCCCCGCGGGG - Intergenic
1150128449 17:62653371-62653393 CCGCCCCCACCCCCGGGGCGGGG + Intronic
1151479588 17:74362211-74362233 CCTCCCCCAACCCCAGGCCTCGG + Intergenic
1151635468 17:75344846-75344868 CCCCTCCCAACCCCCCCGCCTGG + Intronic
1151933343 17:77247016-77247038 CCTCCCCCTGCCCCCGCTCCCGG - Intergenic
1152197213 17:78924926-78924948 GCGACCCCAGCCCCCGCGCGGGG - Intronic
1152282844 17:79395652-79395674 TCTCCCCCAACCCCAACGGGTGG + Intronic
1152337771 17:79707880-79707902 CCTCCCCCAACACCCGCCACAGG - Intergenic
1152642370 17:81454559-81454581 CCTGCCCCTACCCCCGCCCCTGG + Intronic
1152684101 17:81685356-81685378 CCTCCCACAACCCGCGAGCGAGG - Intronic
1152965716 18:112055-112077 CCACCCCCACCCCCCGCCCCCGG - Intergenic
1156422785 18:36973316-36973338 CCTCCCCCGACCCCCCAGCAGGG - Intronic
1156610471 18:38718513-38718535 CCTCCCCCACCCCACCCGCATGG - Intergenic
1159511258 18:69400837-69400859 CCGCCCCCTCCCCCCGCGCCGGG + Intergenic
1159669018 18:71200166-71200188 CCTCCCCCAACCCCTTCCCATGG + Intergenic
1160747813 19:720074-720096 CCTCCCCCAGCCGCAGCGCGGGG + Intronic
1160776811 19:860437-860459 CCTCCCCCCCCGCCCCCGCGCGG + Intronic
1160947941 19:1652206-1652228 CCCCCCCCAACAAGCGCGCGCGG + Intronic
1160983417 19:1827007-1827029 CCTCCTCCACCTCCAGCGCGGGG - Exonic
1161567530 19:5011919-5011941 CCTCCGCCAAGACCCGCGGGTGG - Intronic
1161619983 19:5292828-5292850 CCTCCCCCACCTCCCGGGGGCGG - Intronic
1161743336 19:6039293-6039315 CCTCCCCCATCCCCAGCCCTTGG - Intronic
1162547582 19:11339675-11339697 CCTCCCCCATCCCCCGCTCCGGG - Intronic
1162757847 19:12870968-12870990 CCTCCCCCACCCTCCGCCCAGGG - Intronic
1162909118 19:13840028-13840050 CCTCCCCCCACCCCAGCCCTGGG - Intergenic
1163208265 19:15820411-15820433 CATCCCCCAACCCCAGTCCGTGG - Intergenic
1163370641 19:16899449-16899471 CCTCCACCAACCCCGGCTGGTGG + Intronic
1163830422 19:19544857-19544879 TCTCCGCCAACCCCCGTGCCTGG + Exonic
1164679467 19:30124085-30124107 CCTCCCCACACCCCCGCTGGAGG - Intergenic
1166394371 19:42427926-42427948 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1167073022 19:47231352-47231374 CCCCCCCCTACCTCCGCGCCGGG + Intronic
1167169212 19:47820024-47820046 CCTCCCCCAAACCCCCTGCTAGG - Intronic
1167762229 19:51457149-51457171 GCTCCCCCAACCCCAGGGAGGGG + Intronic
1168184622 19:54691663-54691685 TCTCCCCCAACCCCAGCCCCTGG - Intronic
1168381023 19:55923484-55923506 CCACCCCCTACTCCTGCGCGTGG - Intronic
925348162 2:3184628-3184650 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348174 2:3184666-3184688 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348186 2:3184704-3184726 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348198 2:3184742-3184764 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348210 2:3184780-3184802 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348222 2:3184818-3184840 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348234 2:3184856-3184878 CCTCCACCACCCCACGCGCAGGG + Intergenic
925348256 2:3184932-3184954 CCTCCACCATCCCACGCGCAGGG + Intergenic
925408549 2:3625412-3625434 CCTTCCCTAACCCCCGCCCTGGG - Intronic
926127076 2:10278239-10278261 CCTCCCCCAACCCCAGTCCAGGG - Intergenic
928100951 2:28437102-28437124 CCTCCCCCCACCCCCACCCTGGG - Intergenic
928112702 2:28523602-28523624 CTTCCCCCAACCCCCTCTCCTGG + Intronic
928206045 2:29284311-29284333 GCTGCCCCCACCCCCGCGCCAGG - Intronic
929188551 2:39120274-39120296 CCTTCCCCAGCGCCCGCGCTGGG + Intronic
929564443 2:42975658-42975680 CCTCCCCAAGCCCCAGCTCGGGG - Intergenic
929597717 2:43186762-43186784 CCTCCTCCCACCCCCGCCCAAGG - Intergenic
932484021 2:72070186-72070208 CCTCCCCCAACCTCTGCCCCAGG + Intergenic
932812014 2:74833923-74833945 CCTCCCCCGCCCCCCGCCCCCGG + Intergenic
933985577 2:87589406-87589428 CCTTCCCCAGCCACCTCGCGGGG + Intergenic
936308266 2:111361394-111361416 CCTTCCCCAGCCACCTCGCGGGG - Intergenic
937880668 2:126862114-126862136 CCTCCCCCAGCCTCCTCGTGGGG + Intergenic
937952690 2:127400945-127400967 CCTCGCCTAGCCCCCGCGGGTGG + Intergenic
939149038 2:138451202-138451224 CCTCCCCCAACCCAAGCCCCTGG + Intergenic
941164780 2:162073609-162073631 CCACCCCCACCCCCAGCCCGCGG - Intronic
942911027 2:181244779-181244801 CCGCCCCCAACCCCCGCCCCTGG + Intergenic
944412091 2:199456096-199456118 CCTCCCCCCACCCCCTCCCTAGG - Exonic
944412337 2:199457288-199457310 CTTCCCCGAACTCCCGAGCGCGG + Intronic
946248099 2:218398572-218398594 CCCCTCCCGGCCCCCGCGCGGGG + Intronic
946411414 2:219517083-219517105 CCACCCCCAACTCCCGCTCGGGG - Intronic
946431771 2:219630152-219630174 GCTCCCCCAGCCCCCGGGCCCGG + Exonic
947815685 2:233034747-233034769 GCTTCCCCAGCCCCCGCTCGGGG + Exonic
948468542 2:238163614-238163636 CCTCGCCCCACCCCTGCGCCCGG + Intronic
948953913 2:241272677-241272699 CCACCCCCCACCCCCCCGCCCGG + Intronic
949056866 2:241932513-241932535 CCACCCCCAAACCCCGCCCCAGG - Intergenic
1171767319 20:29297403-29297425 CCCCCCCCAACCCCCGTGGTTGG - Intergenic
1172118427 20:32584516-32584538 CCTGCCCCAAGCCCCGCGGCGGG + Intronic
1172573980 20:35992745-35992767 CCTCCCCCACCCCCCGACCCTGG + Intronic
1173221868 20:41137889-41137911 GCTCCCACGACCCCCGCGCGGGG - Intronic
1173256267 20:41396019-41396041 CCGCCCCCAACCCCTGCCCAAGG + Intergenic
1173913784 20:46690901-46690923 CCTCCCCCTACCCCACCGCCTGG + Intergenic
1174648469 20:52105090-52105112 CGGCCCCCAGCCCCCGGGCGGGG + Intronic
1175268991 20:57720442-57720464 CCCCCCCCACCCCCCCCCCGCGG - Intergenic
1175413234 20:58785121-58785143 CCTCCCCCAAAACCCAGGCGAGG - Intergenic
1175645453 20:60667070-60667092 CCTCCCCCAGCCCCTGCGACTGG + Intergenic
1176030337 20:63008468-63008490 GCTCCCCCGACCCCGGCCCGTGG - Intergenic
1176233963 20:64045581-64045603 CCTCCCCCAACCCCCAACCAAGG - Intronic
1176372163 21:6068782-6068804 CGTCCCCCAACCCCCTCCCTCGG + Intergenic
1176973822 21:15295709-15295731 TCTCCCCCACCCCCCGTCCGAGG - Intergenic
1178840786 21:36136038-36136060 CGTTCCCCCACCCCCGCCCGGGG + Intronic
1179491487 21:41744230-41744252 CCTCCCCCATCTCCCTCCCGTGG - Intronic
1179562118 21:42222091-42222113 CCTTCCCCCACCCCCGCACCGGG - Intronic
1179751356 21:43469757-43469779 CGTCCCCCAACCCCCTCCCTCGG - Intergenic
1180649924 22:17369418-17369440 CCTCCCCCAGGCCCCGCGTCCGG + Exonic
1180871745 22:19150435-19150457 GCGCCCCCGGCCCCCGCGCGCGG - Intergenic
1181026984 22:20132198-20132220 ACTCCCCCAGCCCCAGCGGGTGG - Intronic
1181293800 22:21818910-21818932 CCTCCCCCAGCCCCCGACCATGG - Intronic
1181381476 22:22508318-22508340 CCTCCCCCATCGCCCCCGCGGGG - Intronic
1183201360 22:36387602-36387624 CCTCCCCGAGCGCCCGCGTGGGG + Intronic
1183376499 22:37468346-37468368 CCTCCCCCAACCCAGGCCCTGGG + Intergenic
1183942116 22:41301837-41301859 CGTCCCCGAACCCTCGCGCGCGG - Intronic
1184557523 22:45241122-45241144 CCTCCCTCAAACCGCTCGCGGGG + Intergenic
1184593778 22:45502598-45502620 CCTCCCCCCACCCCCTCTCGAGG - Intronic
1184606178 22:45576032-45576054 CCTCCCCCCACCCCCCCGCATGG - Intronic
950124554 3:10503459-10503481 CCTCCCCCAACGCCTGTGTGAGG + Intronic
953705404 3:45226404-45226426 CCTCTCCCAGCCCCGGCGCGTGG - Intergenic
953858040 3:46516802-46516824 CATCCCCCAACCCCCTCGCTGGG + Exonic
954210352 3:49093731-49093753 CCTCCCCCATCCACAGGGCGGGG + Intronic
954364692 3:50139633-50139655 CCTCCCCCAAGCCCTGCCTGGGG - Intergenic
954382512 3:50227240-50227262 CATCCCCCTTGCCCCGCGCGGGG - Intronic
954701530 3:52453215-52453237 CCTCCCCCAACCCCAGAGCAAGG - Intronic
954876302 3:53805198-53805220 TCTCCCCCAACCCCCGCTCTGGG + Intronic
954886864 3:53882259-53882281 CCGCCCCCAGCCCCTGCGCCGGG - Intergenic
960047310 3:113211005-113211027 CCTCCCCCGACCCCCTCGGTCGG - Intronic
961658662 3:128456993-128457015 CCTCCCCCAGCCCCCTCCAGGGG + Intergenic
961827531 3:129606767-129606789 CCGCCCCCGACCCCGGCGCCCGG + Exonic
962240943 3:133750431-133750453 CTTCCCTCAATCCCCGCGCTGGG + Intronic
963827360 3:149970436-149970458 CCTCCCCCAACCCGGGCACCTGG + Intronic
965343576 3:167519632-167519654 CCTCCCCCATCCCCCACCCCTGG - Intronic
966454126 3:180095123-180095145 CCTCCCCCATCCCCCGGCAGTGG - Intergenic
967985644 3:195093930-195093952 CCTCCCCCAGCCCACGTCCGTGG + Intronic
968046535 3:195626860-195626882 CCTCCCCCATCCCCCATGTGAGG + Intergenic
968225339 3:196969187-196969209 CCTCGCCGACCTCCCGCGCGTGG - Intergenic
968308118 3:197663181-197663203 CCTCCCCCATCCCCCATGTGAGG - Intergenic
968701698 4:2060633-2060655 CCTCCCCCCTCCCCCGCGCGGGG + Intronic
968908677 4:3465927-3465949 CCACCCCCAGCCCCCGCACCTGG - Intronic
968966658 4:3772331-3772353 CCTCCCCCACCCCTTGCACGTGG - Intergenic
969239061 4:5887854-5887876 CACCCTCCCACCCCCGCGCGAGG + Intronic
969283903 4:6190608-6190630 CCACCCCCAACCCCAGCAGGCGG + Intronic
969718080 4:8877953-8877975 CCTCCCCCAACCCCAGGGCCTGG + Intergenic
970011111 4:11459983-11460005 CCACCCCCAACTCCAGCACGGGG + Intergenic
971236960 4:24850843-24850865 CTTCCCCCAACCCCCACCAGAGG - Intronic
972765951 4:42152310-42152332 CATCGCCGAGCCCCCGCGCGGGG + Exonic
975702163 4:77076381-77076403 CCTCCCCCAAGCGCAGCGCTCGG - Intergenic
976790259 4:88870482-88870504 CCCCCCCCAAGCCAGGCGCGGGG - Intronic
978530052 4:109703490-109703512 CCGCCCCCTGCCCCCGAGCGTGG + Intronic
982525047 4:156467378-156467400 CCTCCCCCCTCCCCCACCCGAGG + Intergenic
986747987 5:10760968-10760990 CCGCCCCCGGCACCCGCGCGTGG + Intronic
990323145 5:54649105-54649127 CCTCCCCCACCCCCCGCTGTGGG - Intergenic
992655483 5:78905776-78905798 CCACCCCCAACCTCCGCTCCAGG + Intronic
995142493 5:108749177-108749199 CCCCCCCCAACCCCCGTCCCTGG + Intronic
995527880 5:113065028-113065050 CCTCCCCCAACCCCATCCCCTGG - Intronic
998148931 5:139746217-139746239 CTTCCCCCACCCCCAGCGGGGGG + Intergenic
998366574 5:141636512-141636534 CACCCCCCAACCCCCGGCCGAGG + Intronic
998521133 5:142801689-142801711 CCTCCCCCAGCCCCCGCCTTTGG + Intronic
999300362 5:150486561-150486583 TGTCCTCCCACCCCCGCGCGCGG - Intronic
1001070266 5:168579459-168579481 CGGCCCCCCACCCCCGCGAGGGG + Exonic
1001261619 5:170233815-170233837 CCTCACCCCACCCACGCGCTGGG + Exonic
1002061898 5:176630248-176630270 CGTTCCCCATCCCCGGCGCGCGG + Intronic
1002372842 5:178768766-178768788 CCACCCCCTACCCCTGCACGGGG + Intergenic
1002559015 5:180068161-180068183 CCTCTCCCAACCCCCACTCTGGG + Intronic
1002928887 6:1620234-1620256 CCTCCCTCAAACCCGGAGCGGGG + Intergenic
1003065958 6:2903540-2903562 CCTCACCCACCCCCGGCGCCAGG + Intergenic
1003086226 6:3063688-3063710 CCTCACCCACCCCCGGCGCCAGG - Intergenic
1004250340 6:14018269-14018291 CCTCCCCCCACCCCCCGCCGTGG + Intergenic
1004657442 6:17677403-17677425 CCACCCCCTACCCCCGTGCATGG - Intronic
1006484738 6:34329793-34329815 CCTCCCCCAACCCCACCCCATGG + Intronic
1006656114 6:35594335-35594357 CCTCCCCCACCCCCCGAGACAGG - Intronic
1006983599 6:38163818-38163840 CCTCCCCCAACCCCTGCCCCAGG + Intergenic
1010781219 6:79947601-79947623 CGGCCCCCCGCCCCCGCGCGCGG - Intergenic
1012547375 6:100434885-100434907 CCTTCCCCCACCCCCGCTCCAGG - Intronic
1012937347 6:105382135-105382157 TCTCCCCCAACCCCCGCCTCTGG - Intronic
1013207548 6:107958340-107958362 CCTCCCCCAACCCCTCCCCTAGG + Intergenic
1015880663 6:137867413-137867435 CCTGCCCCGACCCCCGCCTGCGG + Exonic
1016839999 6:148516501-148516523 CCTCCCCCCTCCCCCGCCCTTGG + Intronic
1016872853 6:148836130-148836152 GCTCCCCCAACCCTCCCGTGTGG - Intronic
1018400129 6:163413967-163413989 CCTCCCCCACCGCGCGCTCGCGG + Intergenic
1018902495 6:168058551-168058573 CACCCCCCAACCCCCGCCCCCGG - Intronic
1020704124 7:11521693-11521715 CCTCCCCCGACCCCACCACGAGG + Intronic
1021175013 7:17440234-17440256 CCACCCCCACCCCCTGCCCGTGG + Intergenic
1021221073 7:17975809-17975831 CCTCCCCCCACCCCCACCCCGGG - Intergenic
1021351764 7:19602635-19602657 CCTCTCCCAACCCTGGCGCCAGG + Intergenic
1021798635 7:24283572-24283594 CCCCACCCCACCCCCGCCCGTGG - Intergenic
1021998491 7:26202137-26202159 CCTCCCCCAGCCGCCACGCGGGG + Intronic
1022401050 7:30037938-30037960 CCTCCCCCAACCCCCTCTTAAGG + Intronic
1022973898 7:35539738-35539760 CCTGCCCCAACCCCCTCACAGGG - Intergenic
1023871195 7:44263864-44263886 CCTCTGCCAACCCCCACGTGCGG + Intronic
1023888372 7:44376295-44376317 CCACCCCCAACCCCCCCCCGAGG + Intergenic
1024680178 7:51678231-51678253 CCTCCCCCAGCCCCCACCCCTGG - Intergenic
1024965799 7:55020805-55020827 CCTCCCCCAACGACCGCGCTGGG - Intronic
1025104903 7:56162802-56162824 CCACCCCCAACCCCCATCCGTGG + Intergenic
1025673798 7:63629381-63629403 CCCCCCCCAACCCCCGGGGAAGG - Intergenic
1027171936 7:75878888-75878910 CCCCCCCCCCCCCCCGTGCGTGG - Intronic
1031886602 7:127251699-127251721 CCGCGCCCACGCCCCGCGCGGGG + Intronic
1032125183 7:129188580-129188602 CCTCCCCCAGCCTCGGCGCAGGG + Intergenic
1033253083 7:139777485-139777507 CCTGCCCCAGCCCCCACCCGGGG - Intronic
1033756977 7:144403834-144403856 CCACCCCCACCCCCAGGGCGAGG + Intronic
1034395902 7:150824819-150824841 CCTCCCCCACCCCACTCCCGGGG + Intronic
1036910912 8:12755838-12755860 CGTCCCCCAACCCCCGGCAGGGG - Intronic
1037069510 8:14626303-14626325 CCTCCCCCAACCCCCTCAACAGG + Intronic
1037530355 8:19766831-19766853 CATCCCCCACCCCCTGCCCGTGG + Intergenic
1038156055 8:24991649-24991671 CCTGCCCCAACCCCTGCTTGGGG - Intergenic
1038426777 8:27469024-27469046 CCTCCCCAAAGCCCCACGGGGGG - Intronic
1039858494 8:41436608-41436630 CCTCCCCCAACCCCCCATCCTGG - Intergenic
1040908873 8:52497950-52497972 CCTCCCCCACCCCCCAGGTGGGG - Intergenic
1041928953 8:63266838-63266860 CCTCCCCCAACCCCCCACCCAGG + Intergenic
1042530121 8:69806063-69806085 ACTCCCCCAACCCCCGCCAGAGG + Intronic
1047889761 8:129294762-129294784 CCTCCCCCAACTCCCACCCCTGG - Intergenic
1049093687 8:140535295-140535317 CCTCTCCCCACCCCAGCGCCTGG + Intronic
1049320531 8:141993828-141993850 CTTCCCCCAACCCCAGAGAGGGG + Intergenic
1049508777 8:143017724-143017746 CCTCCCCCTACTCCCGTGTGGGG + Intergenic
1049703880 8:144029045-144029067 CCTCCCCCAACCCCTCCGACAGG - Intronic
1052855933 9:33406636-33406658 CCTACCCCCACCCCTGCGCCTGG - Intergenic
1052997496 9:34559085-34559107 CCTCCCCCCTCCCCCGCCCCCGG + Intronic
1054907024 9:70420717-70420739 CCTCCCCCAACCCCCTACCCCGG + Intergenic
1057619120 9:96619454-96619476 CCGCCCCGAGCGCCCGCGCGGGG - Exonic
1058861188 9:109119296-109119318 CCGCCCCCGTCCCCCGCCCGTGG - Intronic
1059322354 9:113479598-113479620 CATCCCCCAACCCCAGCCCCAGG - Intronic
1060480894 9:124016217-124016239 CCCCACCCCACCCCGGCGCGAGG - Intronic
1060793321 9:126499857-126499879 CCTCCCCCAGCCCGCGGGCCGGG + Intronic
1061484654 9:130914217-130914239 CCTCCCCCAGCCCTCCCGAGGGG + Intronic
1061955790 9:133960701-133960723 CCTCCCCCAGCCCCGGCATGTGG + Intronic
1062341056 9:136094237-136094259 CCTCCCCCAACCCCCGCGCGGGG - Intronic
1062362221 9:136193471-136193493 GCTCCCCCCAGGCCCGCGCGGGG + Intergenic
1062513633 9:136921404-136921426 CCTACCCCGACCCCTGCCCGAGG - Intronic
1187098105 X:16167843-16167865 TGTCCCCCAACCCCCGCCCCCGG + Intronic
1188225981 X:27598350-27598372 CCCCACCCAACCCCCCCGAGGGG + Intronic
1188542530 X:31266491-31266513 CCGGCCCCAATCCCCGCGTGAGG + Intronic
1189327174 X:40119935-40119957 CCTCCCCCAACCCCCCAACTTGG - Intronic
1190473803 X:50808726-50808748 CCTTCCCCAACCCCCTCCCCAGG - Intronic
1191878626 X:65822325-65822347 CCTCCCCCAACAATGGCGCGGGG + Intergenic
1195310657 X:103629209-103629231 CCTCCCCCGTCCCCCGGGAGGGG + Intronic
1195404297 X:104496021-104496043 CCTCCCCCGACCCCCACCCTTGG + Intergenic
1196554322 X:117069741-117069763 CCTCCCCCTTCCCCCGTGCAGGG - Intergenic
1198543869 X:137671006-137671028 CCTCCCCCAACCCCTTTGAGAGG + Intergenic
1199772680 X:150984267-150984289 CCTCCCCGCCCCCCGGCGCGGGG - Intronic
1200097244 X:153670047-153670069 CCTCCCCCAACCCCTCCCCCTGG - Exonic