ID: 1062341238

View in Genome Browser
Species Human (GRCh38)
Location 9:136094811-136094833
Sequence GGTCCCTGGGGAGGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062341219_1062341238 16 Left 1062341219 9:136094772-136094794 CCCCGGCTTCCCCACCCGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341214_1062341238 30 Left 1062341214 9:136094758-136094780 CCGGGCCAGTCCTGCCCCGGCTT 0: 1
1: 1
2: 3
3: 29
4: 311
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341221_1062341238 15 Left 1062341221 9:136094773-136094795 CCCGGCTTCCCCACCCGGAGGGC 0: 1
1: 0
2: 2
3: 19
4: 241
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341229_1062341238 1 Left 1062341229 9:136094787-136094809 CCGGAGGGCTGGATCGGCCAGTC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341226_1062341238 6 Left 1062341226 9:136094782-136094804 CCCACCCGGAGGGCTGGATCGGC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341227_1062341238 5 Left 1062341227 9:136094783-136094805 CCACCCGGAGGGCTGGATCGGCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341215_1062341238 25 Left 1062341215 9:136094763-136094785 CCAGTCCTGCCCCGGCTTCCCCA 0: 1
1: 0
2: 3
3: 62
4: 641
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341222_1062341238 14 Left 1062341222 9:136094774-136094796 CCGGCTTCCCCACCCGGAGGGCT 0: 1
1: 0
2: 3
3: 14
4: 257
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341224_1062341238 7 Left 1062341224 9:136094781-136094803 CCCCACCCGGAGGGCTGGATCGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341216_1062341238 20 Left 1062341216 9:136094768-136094790 CCTGCCCCGGCTTCCCCACCCGG 0: 1
1: 0
2: 2
3: 53
4: 594
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data
1062341228_1062341238 2 Left 1062341228 9:136094786-136094808 CCCGGAGGGCTGGATCGGCCAGT 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062341238 Original CRISPR GGTCCCTGGGGAGGCCGCGC GGG Intronic
No off target data available for this crispr