ID: 1062341582

View in Genome Browser
Species Human (GRCh38)
Location 9:136095793-136095815
Sequence GCGCGCATCCGCAGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062341572_1062341582 15 Left 1062341572 9:136095755-136095777 CCGCACGGTGCAGCCTCCGGGAT No data
Right 1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG No data
1062341580_1062341582 -1 Left 1062341580 9:136095771-136095793 CCGGGATCCGGGCGGGGGAAGTG No data
Right 1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG No data
1062341568_1062341582 30 Left 1062341568 9:136095740-136095762 CCGCGGCAGTCGCGTCCGCACGG No data
Right 1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG No data
1062341581_1062341582 -8 Left 1062341581 9:136095778-136095800 CCGGGCGGGGGAAGTGCGCGCAT No data
Right 1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG No data
1062341579_1062341582 2 Left 1062341579 9:136095768-136095790 CCTCCGGGATCCGGGCGGGGGAA No data
Right 1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062341582 Original CRISPR GCGCGCATCCGCAGCCGCCC TGG Intergenic
No off target data available for this crispr