ID: 1062344036

View in Genome Browser
Species Human (GRCh38)
Location 9:136106713-136106735
Sequence GAAGGATGCTAGACCCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062344036_1062344037 -6 Left 1062344036 9:136106713-136106735 CCAGAGAGGGTCTAGCATCCTTC No data
Right 1062344037 9:136106730-136106752 TCCTTCTACAGACCGACCCCTGG No data
1062344036_1062344042 11 Left 1062344036 9:136106713-136106735 CCAGAGAGGGTCTAGCATCCTTC No data
Right 1062344042 9:136106747-136106769 CCCTGGAGACAGCCCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062344036 Original CRISPR GAAGGATGCTAGACCCTCTC TGG (reversed) Intergenic
No off target data available for this crispr