ID: 1062344287

View in Genome Browser
Species Human (GRCh38)
Location 9:136107687-136107709
Sequence CACCTGTGCTCGGTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062344287_1062344292 -4 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344292 9:136107706-136107728 GGTGGTGGCTGAGTTCCGGTTGG No data
1062344287_1062344301 29 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344301 9:136107739-136107761 GGCTGTGGGGAGAAGAGAGATGG No data
1062344287_1062344295 14 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344295 9:136107724-136107746 GTTGGCCCAGCTCCAGGCTGTGG No data
1062344287_1062344297 16 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344297 9:136107726-136107748 TGGCCCAGCTCCAGGCTGTGGGG No data
1062344287_1062344293 8 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344293 9:136107718-136107740 GTTCCGGTTGGCCCAGCTCCAGG No data
1062344287_1062344291 -8 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344291 9:136107702-136107724 CACAGGTGGTGGCTGAGTTCCGG No data
1062344287_1062344296 15 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344296 9:136107725-136107747 TTGGCCCAGCTCCAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062344287 Original CRISPR CACCTGTGCTCGGTGCAGCC TGG (reversed) Intergenic