ID: 1062344290

View in Genome Browser
Species Human (GRCh38)
Location 9:136107697-136107719
Sequence ACTCAGCCACCACCTGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062344290_1062344301 19 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344301 9:136107739-136107761 GGCTGTGGGGAGAAGAGAGATGG No data
1062344290_1062344296 5 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344296 9:136107725-136107747 TTGGCCCAGCTCCAGGCTGTGGG No data
1062344290_1062344295 4 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344295 9:136107724-136107746 GTTGGCCCAGCTCCAGGCTGTGG No data
1062344290_1062344293 -2 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344293 9:136107718-136107740 GTTCCGGTTGGCCCAGCTCCAGG No data
1062344290_1062344302 22 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344302 9:136107742-136107764 TGTGGGGAGAAGAGAGATGGCGG No data
1062344290_1062344297 6 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344297 9:136107726-136107748 TGGCCCAGCTCCAGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062344290 Original CRISPR ACTCAGCCACCACCTGTGCT CGG (reversed) Intergenic