ID: 1062344293

View in Genome Browser
Species Human (GRCh38)
Location 9:136107718-136107740
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062344290_1062344293 -2 Left 1062344290 9:136107697-136107719 CCGAGCACAGGTGGTGGCTGAGT No data
Right 1062344293 9:136107718-136107740 GTTCCGGTTGGCCCAGCTCCAGG No data
1062344287_1062344293 8 Left 1062344287 9:136107687-136107709 CCAGGCTGCACCGAGCACAGGTG No data
Right 1062344293 9:136107718-136107740 GTTCCGGTTGGCCCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062344293 Original CRISPR GTTCCGGTTGGCCCAGCTCC AGG Intergenic