ID: 1062346635

View in Genome Browser
Species Human (GRCh38)
Location 9:136118202-136118224
Sequence CGGCGGAGCTGTGTCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062346628_1062346635 10 Left 1062346628 9:136118169-136118191 CCCCGGCCATGGCGGTGCCACTC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346625_1062346635 20 Left 1062346625 9:136118159-136118181 CCGGCCGGGACCCCGGCCATGGC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346630_1062346635 8 Left 1062346630 9:136118171-136118193 CCGGCCATGGCGGTGCCACTCAA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346622_1062346635 22 Left 1062346622 9:136118157-136118179 CCCCGGCCGGGACCCCGGCCATG 0: 1
1: 0
2: 1
3: 21
4: 205
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346631_1062346635 4 Left 1062346631 9:136118175-136118197 CCATGGCGGTGCCACTCAAACGC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346629_1062346635 9 Left 1062346629 9:136118170-136118192 CCCGGCCATGGCGGTGCCACTCA 0: 1
1: 0
2: 2
3: 16
4: 144
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346623_1062346635 21 Left 1062346623 9:136118158-136118180 CCCGGCCGGGACCCCGGCCATGG 0: 1
1: 0
2: 2
3: 33
4: 289
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346627_1062346635 16 Left 1062346627 9:136118163-136118185 CCGGGACCCCGGCCATGGCGGTG 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98
1062346634_1062346635 -7 Left 1062346634 9:136118186-136118208 CCACTCAAACGCGACTCGGCGGA 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG 0: 1
1: 0
2: 3
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062346635 Original CRISPR CGGCGGAGCTGTGTCCCCGC AGG Intronic