ID: 1062346694

View in Genome Browser
Species Human (GRCh38)
Location 9:136118400-136118422
Sequence GACCCGGAAGTGGCTCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062346694_1062346698 -2 Left 1062346694 9:136118400-136118422 CCTGCCGGAGCCACTTCCGGGTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1062346698 9:136118421-136118443 TCCCGCGCCGCGCGTTGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 89
1062346694_1062346706 20 Left 1062346694 9:136118400-136118422 CCTGCCGGAGCCACTTCCGGGTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1062346706 9:136118443-136118465 GAGACGGCCCCCGCCTAGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1062346694_1062346701 4 Left 1062346694 9:136118400-136118422 CCTGCCGGAGCCACTTCCGGGTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1062346701 9:136118427-136118449 GCCGCGCGTTGCCCTGGAGACGG 0: 1
1: 0
2: 1
3: 7
4: 76
1062346694_1062346705 16 Left 1062346694 9:136118400-136118422 CCTGCCGGAGCCACTTCCGGGTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1062346705 9:136118439-136118461 CCTGGAGACGGCCCCCGCCTAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1062346694_1062346707 21 Left 1062346694 9:136118400-136118422 CCTGCCGGAGCCACTTCCGGGTC 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1062346707 9:136118444-136118466 AGACGGCCCCCGCCTAGGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062346694 Original CRISPR GACCCGGAAGTGGCTCCGGC AGG (reversed) Intronic
900431976 1:2606812-2606834 GACCCTGAGGTTGCCCCGGCTGG + Intronic
902624530 1:17668868-17668890 GATCTGGAAATGGCTCCGTCTGG + Intronic
904998654 1:34650937-34650959 AACCAGGAAGGGGGTCCGGCGGG - Intergenic
905653584 1:39672082-39672104 GACGCGGAGGTGGCTGGGGCTGG + Intergenic
911017165 1:93345848-93345870 CACCCGGAAGTCGGTCCGGGAGG + Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1066426635 10:35313136-35313158 GATCCTGAAATGGCTGCGGCTGG + Intronic
1067414153 10:46091253-46091275 GAACAGGAAGTGGCTCCTGGAGG + Intergenic
1069607529 10:69749195-69749217 GTCCCTGAAGTGGCTGTGGCTGG + Intergenic
1077081744 11:727425-727447 GGCCCGGGAGGGGCTCCAGCAGG + Exonic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1078428718 11:11271121-11271143 CAGCCGGAAGTGGCCCCGGTGGG + Exonic
1078534669 11:12163387-12163409 GTCCCGGGATTGGCACCGGCTGG - Intronic
1083299914 11:61734932-61734954 GTCCAGGAAGTGGCGCCGGATGG - Exonic
1083820217 11:65166207-65166229 GACCCGGAAGTCCCCCTGGCTGG + Intergenic
1083853941 11:65382894-65382916 GAGCCAGCAGTGCCTCCGGCTGG - Intronic
1084978081 11:72814247-72814269 GACCCGGAGGCGGCTCCTCCCGG + Intergenic
1085079303 11:73620946-73620968 GACAAGGAAGTGGCCCAGGCAGG + Intergenic
1085322589 11:75583853-75583875 GACTGGGAAGTGGCTGCCGCAGG + Intergenic
1089617581 11:119703622-119703644 GACCCACAAGTGGCTGAGGCAGG + Intronic
1091220573 11:133927852-133927874 GACCCGGGAGTGGATCCTGGAGG - Intronic
1100895362 12:99176196-99176218 GACCAGGAAGTGGGTCCTCCAGG + Intronic
1102261952 12:111448253-111448275 GGCCCGCAGGTGGCTCCGGGAGG - Exonic
1111436528 13:88216956-88216978 GATCAGGATCTGGCTCCGGCTGG + Intergenic
1118925697 14:70188499-70188521 GCCCCGGACGCGGCTGCGGCCGG - Exonic
1121708855 14:96021703-96021725 GACTGGGAAGTGGGTCAGGCAGG + Intergenic
1122715433 14:103694119-103694141 GACCCGGAAGATGCTCCAGCTGG - Intergenic
1122722055 14:103727674-103727696 GCCCCGGGTGTGGCCCCGGCTGG - Intronic
1123984286 15:25631084-25631106 GACCCAGAAGTGGCTTCAGCTGG - Intergenic
1128143007 15:65315524-65315546 GAGCCTGAAGTGGCTCTAGCTGG + Intergenic
1131822464 15:96286757-96286779 GTCCCGGAGGTGGCTCAAGCAGG - Intergenic
1132421363 15:101672768-101672790 GCCCCGGAAGTGTCTCCGTGGGG - Intronic
1132685149 16:1159041-1159063 CACCCTGAAGTGCCTCAGGCAGG - Intronic
1140354908 16:74297176-74297198 GGCCCCGAAGTGGCGGCGGCTGG - Intronic
1141079154 16:81035807-81035829 CTGCCGGAAGTGGCTGCGGCGGG + Intergenic
1141214599 16:82011490-82011512 GGCCCGGAAGTGGCTCCAGGAGG - Intergenic
1142435194 16:90052372-90052394 GACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435200 16:90052407-90052429 GACCAGGCAGTGGTTGCGGCCGG - Intergenic
1142435207 16:90052442-90052464 GACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435214 16:90052477-90052499 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435221 16:90052512-90052534 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435228 16:90052547-90052569 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435235 16:90052582-90052604 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435242 16:90052617-90052639 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435249 16:90052652-90052674 GACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435255 16:90052687-90052709 GATCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435262 16:90052722-90052744 GACCAGGCAGTGCTTCCGGCCGG - Intergenic
1142435268 16:90052757-90052779 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435275 16:90052792-90052814 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435282 16:90052827-90052849 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435289 16:90052862-90052884 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435296 16:90052897-90052919 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435303 16:90052932-90052954 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435310 16:90052967-90052989 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435316 16:90053002-90053024 GATCAGGCAGTGGTTCCGGCCGG - Intergenic
1142435323 16:90053037-90053059 GACCAGGCAGTGCTTCCGGCCGG - Intergenic
1142435335 16:90053107-90053129 CACCAGGCAGTGGTTCCGGCCGG - Intergenic
1142563037 17:822428-822450 GACCCGGGTGAGGCTTCGGCAGG + Exonic
1142816924 17:2433886-2433908 GAAAAGGAAGTGGCTCAGGCTGG - Intronic
1143111480 17:4555362-4555384 GACCTGGAAGCGGCTGGGGCCGG - Exonic
1143317895 17:6046590-6046612 GGCCCAGAGGTGGCTCTGGCTGG - Intronic
1144945874 17:18969243-18969265 GCCCAGGAAGTGGCCCCAGCAGG + Exonic
1146208142 17:30922210-30922232 GACCCAGACGTGGCACCTGCGGG + Intronic
1151338504 17:73455226-73455248 GACCCGGGGGTGGCTCAGGAGGG + Intronic
1154145984 18:11866588-11866610 GACCGGGAAGCAGCTCGGGCTGG + Intronic
1157195869 18:45619696-45619718 AGCCCGGACGTGGCTCGGGCAGG + Intronic
1157476401 18:48026395-48026417 CATCCGGAATGGGCTCCGGCTGG - Intergenic
1159782339 18:72674856-72674878 GACCTGGGGGTGGCTGCGGCTGG - Intergenic
1160357634 18:78241753-78241775 GCCACGGAAGAGGCTCCAGCCGG + Intergenic
1161717728 19:5886344-5886366 GAGCTGCAAGGGGCTCCGGCAGG - Intronic
1165657652 19:37548550-37548572 GACCCGGAATTGGGTCCCACGGG - Intronic
1166388942 19:42398090-42398112 GCCCAGGAGGTGGCTCTGGCAGG + Intergenic
1167011771 19:46813399-46813421 GACCCGGGAGTGGGGACGGCCGG + Intergenic
1167615572 19:50531093-50531115 GACCAGGAAGTGGCACAGCCAGG + Intronic
1167978726 19:53254851-53254873 GACCCGGAAGCGGATCTCGCGGG - Exonic
925125056 2:1448406-1448428 GTCACGGAAGTGACTCAGGCGGG - Intronic
928564294 2:32528084-32528106 GACCAGGAAGTGGATCCTACGGG - Intronic
932495543 2:72144213-72144235 GACCCGGGTGTGGCTCCCGCAGG - Exonic
933875753 2:86620237-86620259 GACACGGAAGTGTCACTGGCTGG + Intronic
933893445 2:86790653-86790675 CACCCGGAACTGGCTCGGCCTGG + Exonic
936017660 2:108971994-108972016 GCCTCGCAAGTGGCTGCGGCAGG - Intronic
937132626 2:119524538-119524560 GACCCGGAGTCGGCTCCCGCAGG + Intergenic
937871112 2:126786994-126787016 GGCCTGGAAGTGGCTCAGCCAGG + Intergenic
948207299 2:236168848-236168870 GCCCCGGGGGTGGCTCCGGAGGG - Intergenic
948330029 2:237157271-237157293 GACCTGGCAGTGGCTCCTGAGGG - Intergenic
1172358880 20:34298586-34298608 GACTGGGAAGTGGCGGCGGCGGG + Intronic
1172428613 20:34872846-34872868 CTGCCGGAAGTGGCTGCGGCGGG + Exonic
1173221775 20:41137514-41137536 GACCCGGCGGCGGCTCCTGCAGG - Exonic
1174065882 20:47865898-47865920 GAGAGGGAAGTGGCTACGGCTGG + Intergenic
1174393309 20:50231485-50231507 GACCCAGAGGTTGCTCCAGCTGG + Intergenic
1175024067 20:55882977-55882999 TACCCAGAAGTGGCTGCTGCTGG + Intergenic
1176010396 20:62890563-62890585 CACCGGGAAGTGGCTCCATCAGG - Intronic
1176376926 21:6091462-6091484 GGCCGGGCAGTGGCTCCGGTGGG + Intergenic
1177838305 21:26209983-26210005 GAACATGAAGTGGCTCTGGCCGG - Intergenic
1178511238 21:33206863-33206885 GACCCGGGAGGGGCTACTGCAGG - Intergenic
1179464573 21:41563043-41563065 GACCAGGAAGTTGGTCCTGCTGG + Intergenic
1179746549 21:43446782-43446804 GGCCGGGCAGTGGCTCCGGTGGG - Intergenic
1179888349 21:44324078-44324100 GACCTGGAAGTGGCTATGGCAGG - Intronic
1179989504 21:44939920-44939942 TACCCGGAAGCGGCTCGGGCGGG - Intergenic
1181643516 22:24217597-24217619 GACCATGAACTGGCTCTGGCTGG + Intergenic
1182367567 22:29789220-29789242 CAGCCGGAAGAGGCTCTGGCGGG + Intronic
1183519862 22:38290619-38290641 GACCCGGAAGTGGGTCTTGCTGG - Intergenic
1184980207 22:48090335-48090357 GACCCGGAACGGGCTCTGGCTGG - Intergenic
1185149291 22:49154773-49154795 GCACAGGAAGGGGCTCCGGCTGG - Intergenic
952796539 3:37243755-37243777 GACCCAGAAGGAGCTCCGGGCGG + Intronic
957790067 3:84929397-84929419 GTCCCGGAAGTGGCTCTGATAGG + Intergenic
960691352 3:120349344-120349366 GAGTCGGAAGTGGCGCGGGCGGG + Intergenic
968734324 4:2287589-2287611 GACGTGGAGGTGGCTGCGGCTGG + Intronic
970407716 4:15779085-15779107 GACCCGAAAGTGCCCCCGGACGG + Intronic
971304654 4:25469205-25469227 GACCAGGAAGTGGGTCCTCCAGG + Intergenic
984811213 4:183797752-183797774 GGCCCGGCAGAGGCGCCGGCGGG + Intergenic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
986217799 5:5737178-5737200 CAGTCGGAAGTGGCTCAGGCTGG + Intergenic
987258194 5:16179277-16179299 GGCCAGGAAGTGGCGGCGGCCGG - Exonic
996405019 5:123095532-123095554 GACCCGGGAGTGCCGCCTGCTGG - Intronic
1003421798 6:5965180-5965202 TACCAGCAGGTGGCTCCGGCAGG + Intergenic
1004338241 6:14783885-14783907 CACCCGGAACTCGCGCCGGCCGG + Intergenic
1006402147 6:33824000-33824022 GCGCCGGAGGTGGCTCTGGCTGG + Intergenic
1019817721 7:3213307-3213329 GACTCGGAAGAGGGTCCAGCAGG - Intergenic
1020016420 7:4834530-4834552 GGCCCGGAGCTGGCCCCGGCTGG - Intronic
1021263937 7:18495783-18495805 GTCCTGCAAGTGGCTCCAGCCGG - Intronic
1021329679 7:19320461-19320483 GACCAGGAAGTGGGTCCTGCAGG - Intergenic
1024978377 7:55134245-55134267 GACCTGGATGTGGCTCGGGTGGG - Intronic
1030983391 7:116211468-116211490 AACCCGGGAGTGGCTCAGGTAGG - Intronic
1031482861 7:122299961-122299983 AACCCGGAAGGAGCTCAGGCCGG + Intergenic
1032085992 7:128884208-128884230 GTCCCGGAAGAGGCTGCAGCAGG - Intronic
1034805900 7:154088920-154088942 GAGCCACATGTGGCTCCGGCTGG + Intronic
1034880327 7:154757888-154757910 GACCAGGAAGTGGCTCAGGGAGG + Intronic
1035335233 7:158123803-158123825 GATCGGGAAGTGCCTCCAGCAGG + Intronic
1035622869 8:1047629-1047651 GACCAGGAAGTGGCTGTCGCTGG - Intergenic
1048484129 8:134831899-134831921 GCCCCGGAAGGGGGTCAGGCGGG + Intergenic
1053739388 9:41124176-41124198 GACCCGCAAGAGGCCCAGGCAGG + Intergenic
1054688963 9:68307146-68307168 GACCCGCAAGAGGCCCAGGCAGG - Intergenic
1057612650 9:96560217-96560239 GACCCGGAAGTGGCCCGGTCTGG + Intronic
1058686854 9:107487897-107487919 GACCCGGGCGTGGCGCCGGGCGG - Exonic
1060826368 9:126690352-126690374 GACCAGGCAGTTGCTCGGGCAGG + Intronic
1062346694 9:136118400-136118422 GACCCGGAAGTGGCTCCGGCAGG - Intronic
1189321459 X:40090103-40090125 GAGCCGGAGGTGGCTTTGGCAGG - Intronic
1190301284 X:49059019-49059041 GACCAGGCCCTGGCTCCGGCTGG - Exonic