ID: 1062347476

View in Genome Browser
Species Human (GRCh38)
Location 9:136122037-136122059
Sequence CGAGCAGAGACTGGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062347476_1062347491 23 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347491 9:136122083-136122105 TAGCTGTGAGGGTGGCTTCCCGG No data
1062347476_1062347492 24 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347492 9:136122084-136122106 AGCTGTGAGGGTGGCTTCCCGGG No data
1062347476_1062347487 11 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347487 9:136122071-136122093 GGATGACCACTCTAGCTGTGAGG No data
1062347476_1062347489 15 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347489 9:136122075-136122097 GACCACTCTAGCTGTGAGGGTGG No data
1062347476_1062347484 -10 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347484 9:136122050-136122072 TCTCTGCTCGCCCATGGATGGGG No data
1062347476_1062347488 12 Left 1062347476 9:136122037-136122059 CCTGCCCCGCCAGTCTCTGCTCG No data
Right 1062347488 9:136122072-136122094 GATGACCACTCTAGCTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062347476 Original CRISPR CGAGCAGAGACTGGCGGGGC AGG (reversed) Intergenic
No off target data available for this crispr