ID: 1062348558

View in Genome Browser
Species Human (GRCh38)
Location 9:136127367-136127389
Sequence CTCTGAAAGGGTGATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062348558_1062348565 15 Left 1062348558 9:136127367-136127389 CCTTCCACATCACCCTTTCAGAG No data
Right 1062348565 9:136127405-136127427 TGAAGATTCCCGATTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062348558 Original CRISPR CTCTGAAAGGGTGATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr