ID: 1062348742

View in Genome Browser
Species Human (GRCh38)
Location 9:136128481-136128503
Sequence GCTCCGTGCTGCCCGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062348738_1062348742 8 Left 1062348738 9:136128450-136128472 CCTTTCTGAGGCTGCTGACGTGC No data
Right 1062348742 9:136128481-136128503 GCTCCGTGCTGCCCGCTAGCTGG No data
1062348736_1062348742 25 Left 1062348736 9:136128433-136128455 CCTGCTGATGGGGCTGACCTTTC No data
Right 1062348742 9:136128481-136128503 GCTCCGTGCTGCCCGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062348742 Original CRISPR GCTCCGTGCTGCCCGCTAGC TGG Intergenic
No off target data available for this crispr