ID: 1062349173

View in Genome Browser
Species Human (GRCh38)
Location 9:136130803-136130825
Sequence TGAATTTTGAAGGACATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062349173_1062349180 17 Left 1062349173 9:136130803-136130825 CCTTTCATGTCCTTCAAAATTCA No data
Right 1062349180 9:136130843-136130865 CCAGGAAGCCTTGCTGATTGTGG No data
1062349173_1062349176 -1 Left 1062349173 9:136130803-136130825 CCTTTCATGTCCTTCAAAATTCA No data
Right 1062349176 9:136130825-136130847 AGCTCAAGGCCTCCTCTTCCAGG No data
1062349173_1062349182 22 Left 1062349173 9:136130803-136130825 CCTTTCATGTCCTTCAAAATTCA No data
Right 1062349182 9:136130848-136130870 AAGCCTTGCTGATTGTGGGCCGG No data
1062349173_1062349181 18 Left 1062349173 9:136130803-136130825 CCTTTCATGTCCTTCAAAATTCA No data
Right 1062349181 9:136130844-136130866 CAGGAAGCCTTGCTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062349173 Original CRISPR TGAATTTTGAAGGACATGAA AGG (reversed) Intergenic
No off target data available for this crispr