ID: 1062349519

View in Genome Browser
Species Human (GRCh38)
Location 9:136132259-136132281
Sequence CCCCGGGAGGACCCAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062349501_1062349519 16 Left 1062349501 9:136132220-136132242 CCAAATAACCCCTTCCCTTCCGT No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349511_1062349519 -9 Left 1062349511 9:136132245-136132267 CCTCCTACCCATGCCCCCGGGAG No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349505_1062349519 6 Left 1062349505 9:136132230-136132252 CCTTCCCTTCCGTGGCCTCCTAC No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349507_1062349519 1 Left 1062349507 9:136132235-136132257 CCTTCCGTGGCCTCCTACCCATG No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349504_1062349519 7 Left 1062349504 9:136132229-136132251 CCCTTCCCTTCCGTGGCCTCCTA No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349508_1062349519 -3 Left 1062349508 9:136132239-136132261 CCGTGGCCTCCTACCCATGCCCC No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349506_1062349519 2 Left 1062349506 9:136132234-136132256 CCCTTCCGTGGCCTCCTACCCAT No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data
1062349503_1062349519 8 Left 1062349503 9:136132228-136132250 CCCCTTCCCTTCCGTGGCCTCCT No data
Right 1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062349519 Original CRISPR CCCCGGGAGGACCCAGGCGC AGG Intergenic
No off target data available for this crispr