ID: 1062349899

View in Genome Browser
Species Human (GRCh38)
Location 9:136133457-136133479
Sequence TCCGGGCGCGGGGCTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062349899_1062349917 18 Left 1062349899 9:136133457-136133479 CCGCCCCCAGCCCCGCGCCCGGA No data
Right 1062349917 9:136133498-136133520 TCCTCCTGAGACGGGAAGAGCGG No data
1062349899_1062349912 9 Left 1062349899 9:136133457-136133479 CCGCCCCCAGCCCCGCGCCCGGA No data
Right 1062349912 9:136133489-136133511 CCCTTCCCTTCCTCCTGAGACGG No data
1062349899_1062349920 26 Left 1062349899 9:136133457-136133479 CCGCCCCCAGCCCCGCGCCCGGA No data
Right 1062349920 9:136133506-136133528 AGACGGGAAGAGCGGCCCCGCGG No data
1062349899_1062349914 10 Left 1062349899 9:136133457-136133479 CCGCCCCCAGCCCCGCGCCCGGA No data
Right 1062349914 9:136133490-136133512 CCTTCCCTTCCTCCTGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062349899 Original CRISPR TCCGGGCGCGGGGCTGGGGG CGG (reversed) Intergenic
No off target data available for this crispr